zoology, Biology

Assignment Help:
right classification of protozoa up to class

Related Discussions:- zoology

Tanco beans plant, what are the origin, morphology, active constituents, us...

what are the origin, morphology, active constituents, uses and market preparation of tanco beans ?

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

What are the physiological systems, What are the physiological systems know...

What are the physiological systems known as integrative systems? Why is this designation justified? The integrative systems are the nervous system and the endocrine system. The

Reproduction, what is the difference between anisogamy and oogamy?

what is the difference between anisogamy and oogamy?

Common respiratory disorders, COMMON RESPIRATORY DISORDERS: Respiratio...

COMMON RESPIRATORY DISORDERS: Respiration is one of the most vital functions of the body. The purpose of respiration is to provide oxygen ta  the body  cells and to remove exc

What are the elements that form the middle ear, Q. What are the elements th...

Q. What are the elements that form the middle ear? What are the names of the three middle ear ossicles that participate in the phonosensitivity? The middle ear is formed by the

Are nematodes exclusively parasites, Are nematodes exclusively parasites? ...

Are nematodes exclusively parasites? There are parasitic roundworms, containing parasites of plants, but there are also free-living nematodes.

Isomerization of dihydroxyacetone phosphate, Isomerization of dihydroxyacet...

Isomerization of dihydroxyacetone phosphate Isomerization  of  dihydroxyacetone phosphate: Triosephosphate isomerase interconverts  dihydroxyacetone phosphate and  glyceralde

Define exocytosis , A cell frequently wants to secrete larger molecule...

A cell frequently wants to secrete larger molecules than can be accommodated through the transport systems dealt with in Topic E3. Exocytoses get to the movement of proteins out of

When a fatty acid reacts with thew glycerol, When a fatty acid reacts with ...

When a fatty acid reacts with glycerol, the result is- Select one: a. Formation of an amide b. Formation of an ester c. Formation of hydrocarbon d. Formation of a th

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd