zoology, Biology

Assignment Help:
#question.characteristics of coelenterata?.

Related Discussions:- zoology

Why do preserved foods not spoil, Why do preserved foods not spoil? Pla...

Why do preserved foods not spoil? Plant and animal cells must stay in an isotonic, or neutral, solution to survive. When salt or sugar is added, more of the cells wither and di

Destruction of microorganisms, Q. Destruction of microorganisms? Ans. ...

Q. Destruction of microorganisms? Ans. Destruction or control of growth of microorganisms is the basis of food preservation. To 'preserve' actually means fro keep safe, r

Measure to be taken in the event of tsunami, ·          If we are in danger...

·          If we are in dangerous areas, water, gas and electricity should be turned off quickly and we should move to a higher level of ground.                  ·          It s

Determine the human genome project, List three important discoveries that r...

List three important discoveries that resulted from the Human Genome Project. Answers should contain three of the following: Only about 2 percent of the human genome encodes p

Irritability, Irritability If a bright torch of light is flashed acros...

Irritability If a bright torch of light is flashed across your eyes, you close your eyes instinctively. The bright light acts as a stimulus (pl, stimuli) and closing your eyes

In how many parts hydrocolloids be classified, In how many parts Classifica...

In how many parts Classification of Hydrocolloids Hydrocolloids, based on their solubility, thickening and gelling properties in water, are categorized into two main classes.

Provide evidence to explain the conversion, Provide supporting evidence to ...

Provide supporting evidence to explain how conversion of a normal somatic cell into a malignant one requires multiple mutations.

How the visual images are projected, Since the visual images are projected ...

Since the visual images are projected in an inverted manner on the retina why don't we see things upside down? As the crystalline lens is a convex spherical lens it forms inver

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

State the concepts of soil- pedology and edaphology, State the concespts of...

State the concespts of soil- pedology and edaphology In the last two centuries of scientific study, two concepts or approaches to the study of soil have evolved.  One called  p

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd