zoology, Biology

Assignment Help:
adaptation and distribution of synaptura (flat fish)

Related Discussions:- zoology

What do you mean by qrs changes, Q. What do you mean by QRS Changes? Th...

Q. What do you mean by QRS Changes? The total amplitude of the QRS compared with exercise usually decreases near peak workload, as well as the T-wave amplitude, and there is a

Rabbit, reproductive system of rabbit

reproductive system of rabbit

Respiration in animal, what is respiration in animals ,its functions ,types...

what is respiration in animals ,its functions ,types of respiration

Causes of degradation of ecosystem due to agriculture, Causes of Degradatio...

Causes of Degradation of Ecosystem Due to Agriculture Degradation of the ecosystem due to agriculture can be on the following accounts: a) Removal of trees (deforestation

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

What are integral membrane proteins, Membrane proteins are classify as eith...

Membrane proteins are classify as either integral (intrinsic) or peripheral (extrinsic) depending on how tightly they are linked with membrane. The Integral membrane proteins are s

Stereoisomers , Glyceraldehyde has a one asymmetric carbon atom the central...

Glyceraldehyde has a one asymmetric carbon atom the central one and so two stereoisomers  which is also known as optical isomers are possible, which is two forms of glyceraldehyde,

Which of the vertebrate classes are warm-blooded, Which of the vertebrate c...

Which of the vertebrate classes (a) are 'warm-blooded', (b) reproduce by laying eggs?   (a) Birds and mammals are 'warm-blooded'. (b) Fish, Amphibia, Reptiles

What are the tissues that form the digestive tube wall, Q. From the lumen t...

Q. From the lumen to the external surface what are the tissues that form the digestive tube wall? From the internal surface to the external surface, the digestive tube wall is

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd