porifera, Biology

Assignment Help:
what are the general characteristicss of porifera

Related Discussions:- porifera

Circulatory system transports gases, Q. What are the three kinds of respira...

Q. What are the three kinds of respiration in which the circulatory system transports gases? The circulatory system has an important role in branchial respiration, cutaneous re

#green algae, #what characteristics of green algae that led to biologists c...

#what characteristics of green algae that led to biologists considered it as a plant?

Industrial melanism, In this section, we shall discuss a classic example of...

In this section, we shall discuss a classic example of natulal selection in action. In the preceding unit, it was stated that natural selection always aims at eliminating alleles,

Where may bacteria be found, Where may bacteria be found? Expose steril...

Where may bacteria be found? Expose sterile bacteria dishes to as lots of the following conditions as you can. Label the dishes and set them away in a warm, dark place for a so

Briefly explain about archenteron and blastopore, Q. What are the archenter...

Q. What are the archenteron and the blastopore? What is the stage of the embryonic development in which these structures are formed? What are the destinations of the archenteron an

Pressure flow mechanism for translocation, experiments that support pressur...

experiments that support pressure flow as a mechanism for translocation

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

State the medial pterygoid, Medial pterygoid Muscle bounds the pterygom...

Medial pterygoid Muscle bounds the pterygomandibular space medially which is entered when an inferior alveolar nerve block is administered. Infection of this space is dangerous

Define determinants of food security - food access, Define Determinants of ...

Define Determinants of Food Security - Food Access? Food access is linked to its affordability. Food access is ensured when households and all individuals within them have adeq

Name the final stage of cell division, During final stage of cell division,...

During final stage of cell division, mitotic apparatus disappears, chromosomes become attenuated, centrioles duplicate and split, nuclear membrane becomes reconstituted and nucleol

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd