Plant, biology, Biology

Assignment Help:
what is the scientific explanation of "touch me not" plant that can react due to any touch

Related Discussions:- Plant, biology

Amylase stock solution, Assume that you have 1 mL of a solution amylase (an...

Assume that you have 1 mL of a solution amylase (an enzyme) at a concentration of 15 mg protein/mL. Calculate the volume of diluting buffer that you would have to add to 1.0 mL of

Why physiological cause of the syndrome called as cretinism, Q. What is the...

Q. What is the physiological cause of the syndrome Called as cretinism? Cretinism is caused by chronic deficiency of the thyroid hormones (T4and T3) during childhood. The chron

Zearalenone, Zearalenone It was first isolated as the agent responsibl...

Zearalenone It was first isolated as the agent responsible for vulvovaginitis in pigs has very little acute toxicity, but there should be some concern about chronic exposure t

Animal husbandry-source of energy and protein, Source of Energy and Protein...

Source of Energy and Protein The by-products obtained from grain processing (brans), oil seed processing (oil meals) and pulses processing industries are the major and importan

Common respiratory disorders, COMMON RESPIRATORY DISORDERS: Respiratio...

COMMON RESPIRATORY DISORDERS: Respiration is one of the most vital functions of the body. The purpose of respiration is to provide oxygen ta  the body  cells and to remove exc

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

How many cells are in the average human brain, How many cells are in the av...

How many cells are in the average human brain? Roughly, 6 trillion are in the average human brain.

Determine the term - leuconoid sponge, Determine the term - Leuconoid spong...

Determine the term - Leuconoid sponge. The most complex of the three different sponge architectures. Choanocytes are found in chambers, and there is not any spongocoel. Water e

Is the embryonic development in birds indirect or direct, Q. Is the embryon...

Q. Is the embryonic development in birds indirect or direct? The embryonic development is direct there is no larval stage. Q. What are the predominating chemical compounds

Physiological & socio psychological factor- public nutrition, Define Physio...

Define Physiological and Socio Psychological Factors - public nutrition? Food related behaviour depends on a combination of biochemical factors, mainly, physiological aspects a

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd