Plant, biology, Biology

Assignment Help:
what is the scientific explanation of "touch me not" plant that can react due to any touch

Related Discussions:- Plant, biology

Signs and symptoms of hypoglycaemia, Q. Signs and Symptoms of Hypoglycaemia...

Q. Signs and Symptoms of Hypoglycaemia? Let us now learn about signs and symptoms of hypoglycaemia. It is important for you know these because you can help the patient and fami

Classification, list the major species of echinodermata

list the major species of echinodermata

Mode of nutrition , What is the mode of nutrition in fish,human,amoeba,scor...

What is the mode of nutrition in fish,human,amoeba,scorpian & toad ?

Seed, Seed A seed is a mature ovule enclosing an embryonic plant, stor...

Seed A seed is a mature ovule enclosing an embryonic plant, stored food material (in endosperm, persistent nucellus or embryo itself) and a seed coat formed by one or two inte

Discuss the evolution of implants in dentistry, Q. Discuss the evolution of...

Q. Discuss the evolution of implants in dentistry? The first use of Implants dates back to 600 A.D. in the Mayan population where intraosseous implantation of animal teeth or t

Define principle of fehling test - reduction tests, Define Principle of feh...

Define Principle of fehling test - reduction tests? Sugars that possess a free or potentially free (those that can be converted to free) aldehyde or ketonic group have a proper

Flow cytometry, Flow cytometry is an analysis of biological material by de...

Flow cytometry is an analysis of biological material by detection of light- absorbing or fluorescing properties of cells or subcellular fractions (that is chromosomes) passing in

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Determine the weiss theory of fibroosseous fixation, Weiss's Theory of Fibr...

Weiss's Theory of Fibroosseous Fixation Weiss' theory stated that there is a fibro-osseous ligament formed between the implant and the bone and this ligament can be considered

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd