obelia, Biology

Assignment Help:
why is obelia considered to of special interest in Zoology as an animal showing an intermediate grade of organisation?

Related Discussions:- obelia

What proportion of the offspring, A laboratory mouse homozygous for an RFLP...

A laboratory mouse homozygous for an RFLP marker is mated to a wild mouse that is heterozygous for that marker. One of the heterozygous individuals resulting from this cross is mat

Two major causes of severe protein energy malnutrition, Explain Two major c...

Explain Two major causes of severe Protein Energy Malnutrition? Two major causes of severe PEM are diluted milk formulae and infections, especially diarrhoea in poor communiti

Define the best describes this autopsy finding, A 70-year old woman present...

A 70-year old woman presents with a 1-hour history of crushing substernal chest pain. Shortly after admission, the patient expires. An autopsy reveals calcium deposits in the intim

Class of crustacea - copepoda, Class of Crustacea - Copepoda Copepoda ...

Class of Crustacea - Copepoda Copepoda is a huge class of small (1-5mm) crustaceans occupying both marine and freshwater environments. Copepods form the several abundant and c

Show common contraindications of the contraceptive pills, Q. What are the c...

Q. What are the common contraindications of the contraceptive pills? There are medical reports associating the use of contraceptive pills with vomiting, headaches, vertigo, nau

Basic research terms - nursing research, Basic Research Terms: Some of...

Basic Research Terms: Some of the basic  terms that are defined  in  this section are:  Assumptions Operational Definitions  Variables  Delimitation and Limitation  H

Exercise induced ventricular arrhythmias, Ventricular arrhythmias are usual...

Ventricular arrhythmias are usually produced by excess catecholamines and vagal withdrawal and occasionally re-entry and triggered activity also plays a role. PVCs are more common

Basic morphological features of echinoderms, Q. What are the basic morpholo...

Q. What are the basic morphological features of echinoderms? Echinoderms, as the name indicates (derma = skin, echino = spiny), are creatures with spines originated from an end

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd