classification, Biology

Assignment Help:
what is entero coelom

Related Discussions:- classification

What are dna ligases, What are DNA ligases? How do these enzymes participat...

What are DNA ligases? How do these enzymes participate in the recombinant DNA technology? The DNA ligases are enzymes specialized in tying the complementary DNA chains that for

Explain gametophyte, "In these autotrophs, sporophyte is the dominant gener...

"In these autotrophs, sporophyte is the dominant generation. Gametophyte is also photosynthetic and not dependent on sporophyte for nutrition."  These autotrophs are:  a.  P

Determine possible polypeptides, a) The image above is part of a DNA sequen...

a) The image above is part of a DNA sequencing gel. Assuming this is the DNA coding strand and you are reading 5' -> 3' what are ALL the possible polypeptides this sequence cou

Agro industrial-evaluation of feedstuff, Evaluation of feedstuff In th...

Evaluation of feedstuff In the feed manufacturing process evaluation of the feed ingredients is very important in achieving consistent quality throughout the year. If one is a

Explain the resting membrane voltage, At 1 AM, a researcher places a health...

At 1 AM, a researcher places a healthy squid giant axon in a bath of normal squid physiological extracellular saline and internally perfuses the axon with normal squid intracellula

What is the equilibrium state of the system, For each of the cases that fol...

For each of the cases that follow, list as many properties of the equilibrium state as you can, specially the constrains placed on the equilibrium state of the system by its surrou

Adult (post natal) stem cells-types of stem cells, Adult (Post natal) stem ...

Adult (Post natal) stem cells : act as repair system for the body replenishing specialized cells but also maintain the normal turnover of regenerative organs such as blood, skin o

Wace, Excretory organ of lizard.

Excretory organ of lizard.

What are the etiological agents of malaria, Q. What are the etiological age...

Q. What are the etiological agents of malaria? The etiological agents of malaria are protozoans of the genus Plasmodium. There are four different kinds of plasmodia that cause

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd