Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
What is Anti-arrhythmic pacemaker defibrillators ? Antiarrhythmic drugs (AADs) are classified according to whether they exert blocking actions predominantly on sodium, potassiu
The metabolism of phenylalanine will now be taken in some detail, as two inborn errors of metabolism are known which affect this pathway. The Phenylalanine is 1st hydroxylated by p
give an account of specific characters of phylum porifera
S-Gene The S-gene has been suggested to be a super gene complex with several linked genes. It is supposed to have at least six (may he more) closely-linked genes which determi
ORGANIZER THEORY - It was propounded by spemann (1901). He was given Nobel prize of 1935 for this wrok. He studied the embryonic development of frog, newt & other amph
Explain the Pour Plate Method Isolated colonies can also be obtained by pour plate method. The method involves mixing of small volume of microbial suspension with molten nutrie
Define Transport Proteins in Plasma? Transport proteins, embedded in lipid membranes, make easy the import of nutrients into cells or the release of toxic products into the sur
What is diffusion? Diffusion is the spreading of substance molecules from a region where the substance is more concentrated to another region where it is less concentrated. For
Define the Bioavailability of cyanocobalamin? Vitamin B 12 is widely available. Availability is more from non-vegetarian foods as described earlier under the food sources sec
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd