aschelminthes, Biology

Assignment Help:
in what part of the human body aschelminthes found?

Related Discussions:- aschelminthes

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

What is anti-arrhythmic pacemaker defibrillators, What is Anti-arrhythmic p...

What is Anti-arrhythmic pacemaker defibrillators ? Antiarrhythmic drugs (AADs) are classified according to whether they exert blocking actions predominantly on sodium, potassiu

Metabolism of phenylalanine, The metabolism of phenylalanine will now be ta...

The metabolism of phenylalanine will now be taken in some detail, as two inborn errors of metabolism are known which affect this pathway. The Phenylalanine is 1st hydroxylated by p

Zoology, give an account of specific characters of phylum porifera

give an account of specific characters of phylum porifera

S-gene, S-Gene The S-gene has been suggested to be a super gene comple...

S-Gene The S-gene has been suggested to be a super gene complex with several linked genes. It is supposed to have at least six (may he more) closely-linked genes which determi

Theory of embryology - organizer theory, ORGANIZER THEORY - It was p...

ORGANIZER THEORY - It was propounded by spemann (1901). He was given Nobel prize of 1935 for this wrok. He studied the embryonic development of frog, newt & other amph

Explain the pour plate method, Explain the Pour Plate Method Isolated c...

Explain the Pour Plate Method Isolated colonies can also be obtained by pour plate method. The method involves mixing of small volume of microbial suspension with molten nutrie

Define transport proteins in plasma, Define Transport Proteins in Plasma? ...

Define Transport Proteins in Plasma? Transport proteins, embedded in lipid membranes, make easy the import of nutrients into cells or the release of toxic products into the sur

What is diffusion, What is diffusion? Diffusion is the spreading of sub...

What is diffusion? Diffusion is the spreading of substance molecules from a region where the substance is more concentrated to another region where it is less concentrated. For

Define the bioavailability of cyanocobalamin, Define the Bioavailability of...

Define the Bioavailability of cyanocobalamin? Vitamin B 12 is widely available. Availability is more from non-vegetarian foods as described earlier under the food sources sec

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd