Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Describe the theory of Darwin's? Most scientists today accept the theory that living organisms have evolved according to the concept that was first proposed by Charles Darwin i
What are few examples of phenotypical characteristics that present two or more varieties and of phenotypical features that do not vary? In relation to the genes correspondent to th
Explan Ketogenic diet Ketogenic diet: It is occasionally used to facilitate the control of epilepsy. Here, the patient is initially fasted for 48 hours and thereafter,
Until the Krebs cycle, aerobic respiration can be explained without mentioning oxygen, the chemical element after which the reaction gets its name. Where in the process does this c
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Does the environment exert an influence on the phenotype? The phenotype may be altered (compared to the original situation conditioned by its genotype) by nongenetic means, ins
Osmoregulatory Animal An osmoregulatory animal is generally in an osmotic steady state even though there may be hourly and daily variations in osmotic balance. The concentrati
What two biotic factors could affect an antelope living in the Serengeti? The biotic factors that may affect an antelope living in the Serengeti could be:predation by carnivore
How do the availability of water and light and the climate affect the growth of a population? The availability of water and light and the climate are abiotic factors that limi
Plastids The term plastid first used by Haeckel (1865). These are present in plants and few protists (Euglena). On the basis of function plastids are of three types
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd