Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Explain the Birth in human biology? In humans, birth of the infant occurs about 270 days after conception. The period during which the uterus contracts to expel the newborn
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
(1) The 7,893 bp plasmid shown below was digested with a series of restriction enzymes (P = PstI, B = BamHI, S = SalI, X = XbaI). Answer the questions below. a) Indicate
In this 1st step, the corresponding aminoacyl-tRNA for the second codon binds to the A site by codon-anticodon interaction. Binding of the aminoacyl-tRNA needs elon
Q. Explain Spoilage of Cereals and Cereal Products? Cereals are the main source of energy to human beings. There are several varieties of cereals, of which wheat and rice are t
what are the names of karyotypes?
Calculate the pH: 300mL of 0.25M sodium ascorbate plus 150mL of 0.2M HCl (the pKa of ascorbic acid is 4.04) okay, what's the conjugate acid and base of this problem? Can someone wa
Mechanical removal of Gutta percha - use k file to create channel then removed by H file Remove gutta percha by rotary ( Gates Glidden = GG ) - use suitable size and remo
Which one of the following kinds of animals are triploblastic? 1. Flat worms 2. Sponges 3. Ctenophores 4. Corals Flat worms
Find the initial osmotic pressure at room temperature of a cell if the only ions present are CaCl2 on either side of the membrane. Assume the concentrastions for K+ and Cl- from Ta
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd