Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
THYMUS -
It is derived from the endoderm of the embryo.
Structure. The thymus gland is located in the upper part of the thorax near the heart. It is a soft, pinkish, bilobed mass of lymphoid tissue. It is a prominent gland at the time of birth but it gradually atrophies In the adult.
Hassall's corpuscles are spherical or oval bodies present in the thymus. They are phagocytic in function.
Hormone. Thymus secretes a hormone named thymosin which stimulates the development of certain kinds of white blood cells involved in producing immunity. It also hastens attainment of sexual maturity.
Thymosin hormone stimulates the lymphocytes to destroy the antigens produced by bacteria or pathogen. It self may be destroyed by these lymphocytes.
The cardiac output is the volume of blood pumped from the heart every minute. It is obtained by the volume pumped with each beat (stroke volume) multiplied by the heart rate. The c
What are clotting factors? Clotting factors are substances (enzymes, coenzymes, reagents) essential for the clotting stages to happen. Besides those triggering factors and reag
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Describe how a phagocyte destroys bacteria. The phagocyte forms a pouch in its cell membrane and engulfs bacteria in the pouch. It then pinches off the pouch to produce a vesi
Morphological Nature of Endosperm The morphological nature of endosperm in angiosperms has been a subject of much discussion in evolution. The endosperm in gymnosperms is a g
Do all mammals have a placenta? Mammals of the monotreme group (echidnas, platypus,) are oviparous, egg-laying, and they do not have a placenta. Mammals of the marsupial group
Describe how many bones are there in human foot The human foot is a great mechanical marvel. It has 26 bones, 29 joints, and 42, various ligaments, a sensitive and protective s
Assume an experimental target that is to make vast amounts of a particular DNA fragment in pure form from a combination of DNA fragments. Whereas the DNA fragments can be introduc
NERV E FIBRES - Axon or dendrite of a nerve cell covered with one, two or three sheaths is called nerve fibre. Dendrites are surrounded only by one sheath. An axon may b
Q. Write in 3-4 lines about the term belief? Beliefs are learned by us when we were young. These include religious beliefs and beliefs about behaviour. Some beliefs lead to hea
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd