Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Third Week - Embryonic Development
Throughout the third week of development the ICM separates from the uophoblast and forms the flattened embryonic disc, which at first consists of cells of all three germ layers, ectoderm, endoderm and mesoderm and is termed as the epiblast. From this a lower layer separates to form the endoderm. The second layer, mesoderm, forms through the migration of cells through the primitive streak that forms as the embryonic disc elongates. The cells remaining in the upper layer make the ectoderm. These three germ layers will give rise to all the organs of the body as pointed out in Figure.
Figure: The organs of the body form from the three germ layers
The embryo's heart as well begins its development as a pair of microscopic tubes. The cardiovascular system is the first system to become functional in the embryo. At the end of the 3rd week the heart tubes fuse and become linked to the blood vessels in the embryo, body stalk, chorion and yolk sac, to make a primitive blood circulatory system. Chorionic villi (that will form the placenta later) also begin to form during this period.
Vascular Preoperative administration of a cephalosporin decreases the incidence of postoperative surgical site infection after arterial reconstructive surgery on the abdominal
Explain Identification of Cancer Cells from Normal Cells? Cancer cells can be distinguished from normal cells by examining them under a microscope. In a specific tissue cancer
rennin
Hydrophilic and some lipophilic hormones bind to cell surface receptors. These are necessary membrane proteins located in the plasma membrane which bind the signaling mol
Micro-organisms: The micro-organisms mixed up in aerobic absorption and their activities are the same as those found in nature. The organic compounds are oxidised to H
Question 1 What is autologous transfusion? Discuss how would you handle and prepare blood for autologous blood transfusion. List the advantages of autologous transfusion Qu
Enrichment of soil Indirect provision of minerals to grazing livestock includes mineral fertilization of pasture and altering soil pH, however this may not be always feasible
Which of the following serves as an actuating signal, or as part of an actuating signal, in a negative feedback system? A. Blood plasma levels of Glucose. B. Blood plasma le
Q. How is the respiratory system in aquatic molluscs characterized? What adaptive respiratory structure do terrestrial molluscs present? In terrestrial molluscs the rich vascul
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd