Third week - embryonic development, Biology

Assignment Help:

Third Week - Embryonic Development

Throughout the third week of development the ICM separates from the uophoblast and forms the flattened embryonic disc, which at first consists of cells of all three germ layers, ectoderm, endoderm and mesoderm and is termed as the epiblast. From this a lower layer separates to form the endoderm. The second layer, mesoderm, forms through the migration of cells through the primitive streak that forms as the embryonic disc elongates. The cells remaining in the upper layer make the ectoderm. These three germ layers will give rise to all the organs of the body as pointed out in Figure.

2006_Third Week.png

Figure: The organs of the body form from the three germ layers

The embryo's heart as well begins its development as a pair of microscopic tubes. The cardiovascular system is the first system to become functional in the embryo. At the end of the 3rd week the heart tubes fuse and become linked to the blood vessels in the embryo, body stalk, chorion and yolk sac, to make a primitive blood circulatory system. Chorionic villi (that will form the placenta later) also begin to form during this period.


Related Discussions:- Third week - embryonic development

What is vascular, Vascular Preoperative administration of a cephalospor...

Vascular Preoperative administration of a cephalosporin decreases the incidence of postoperative surgical site infection after arterial reconstructive surgery on the abdominal

Explain identification of cancer cells from normal cells, Explain Identific...

Explain Identification of Cancer Cells from Normal Cells? Cancer cells can be distinguished from normal cells by examining them under a microscope. In a specific tissue cancer

Cell surface receptors, Hydrophilic and some lipophilic hormones bind to ce...

Hydrophilic and some lipophilic hormones bind to cell surface receptors. These are necessary  membrane  proteins  located  in the plasma  membrane  which  bind  the  signaling  mol

Micro-organisms, Micro-organisms: The micro-organisms mixed up i...

Micro-organisms: The micro-organisms mixed up in aerobic absorption and their activities are the same as those found in nature. The organic compounds are oxidised to H

What is autologous transfusion, Question 1 What is autologous transfusi...

Question 1 What is autologous transfusion? Discuss how would you handle and prepare blood for autologous blood transfusion. List the advantages of autologous transfusion Qu

Agro industrial-enrichment of soil, Enrichment of soil Indirect provis...

Enrichment of soil Indirect provision of minerals to grazing livestock includes mineral fertilization of  pasture and altering soil pH, however this may not be always feasible

Determine the blood plasma levels of glucose, Which of the following serves...

Which of the following serves as an actuating signal, or as part of an actuating signal, in a negative feedback system? A. Blood plasma levels of Glucose. B. Blood plasma le

How the respiratory system in aquatic molluscs characterized, Q. How is the...

Q. How is the respiratory system in aquatic molluscs characterized? What adaptive respiratory structure do terrestrial molluscs present? In terrestrial molluscs the rich vascul

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd