Thermodynamics and energy, Biology

Assignment Help:

Thermodynamics and Energy

  • 2 types of energy (kinetic and potential)
  • Work is the transfer of energy from one place to another
  • Energy isn't lost, only converted è first law of thermodynamics
  • Bond energy is the measure of the stability of a covalent bond
  • Activation energy à the energy it takes to reach the transition state
  • Transition state à the temporary condition in which the bonds of the reactants are breaking and the bonds of the products are forming

 

 

The Combustion Accountant

1.      Draw out molecule to see all bonds

2.      Take each type of bond

a.      Energy produced x # of bonds

3.      Add the energy of the molecule

4.      Do this for all reactants and then again for all products

5.      Add the energy of the reactants together (same with products)

6.      Take the ΔHproducts - ΔHreactants = 'actual' yeild

7.      Find the theoretical yield (in appendix or given)

8.      Theoretical - actual / actual  x 100%  = percent difference

 

  • ΔH->enthalpy à energy change in a reaction (negative is exothermic and positive is endothermic)
    • Exogonic reactions are more spontaneous then endogonic ones
  • ΔS-> Entropy à the measure of the disorder in a system
    • Increase in entropy is favoured
  • Gibbs free energy ΔG
    • Useful energy that can perform work
  • Energy will be lost as heat when converted è second law of thermodynamics
  • Metabolic processes are reversible

 


Related Discussions:- Thermodynamics and energy

Define the term- adaptation, Define the term- Adaptation The terms sco...

Define the term- Adaptation The terms scotopic and photopic vision are relative to the lighting conditions of an individual place. Light adaptation is a very quick process and

What is patient''s plasma osmolarity after the infusion, Tina administered ...

Tina administered 1 liter of sterile distilled water IV to a patient. Predict the direction (increase, decrease, no change) you would expect Tina's infusion to have produced in the

Determine the viscosity of solutions, Viscosity Viscosity, as you may ...

Viscosity Viscosity, as you may already know, is associated with fluid flow.  It is the internal friction which tends to bring to rest portions of the fluids moving relative to

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Zoonoses disease-plague, Plague Plague is an acute and highly fatal di...

Plague Plague is an acute and highly fatal disease caused by Yersinia pestis and transmitted by the bite of infected rat fleas. It is primarily a disease of rodents and small

Define proline, Define Proline It is a prominent amino acid found in fi...

Define Proline It is a prominent amino acid found in fish and may contribute to sweetness. The sugars ribose, glucose and glucose-6-phosphate are flavour contributors, as is 5-

Explain threaded implants, Q. Explain threaded implants? Cylindrical no...

Q. Explain threaded implants? Cylindrical non-threaded implants poorly distribute compressive forces and generate shears forces that may fragment and break the bone surrounding

Atypical distribution of pleural fluid, Q. Atypical Distribution of Pleural...

Q. Atypical Distribution of Pleural Fluid? i) Lamellar effusion: These are shallow collections of fluid between the chest wall and the lung surface. ii) Subpulmonic

Name the process in that substances carry across membrane, Substances which...

Substances which are insoluble in a membrane are carried across membrane with concentration gradient by means of a carrier molecule in a process termed as: a) Diffusion. b)

Differences between prokaryotic & eukaryotic cells, DIFFERENCES BETWEEN PRO...

DIFFERENCES BETWEEN PROKARYOTIC & EUKARYOTIC CELLS   S . N o .   CHA R AC T ERS   P R O K AR Y O T I C CELL

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd