Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Thermodynamics and Cell Shapes
Why are protoplasts (cells devoid of cell wall) spherical? Why are most of the unicellular organisms (prokaryotes and eukaryotes) spherical? A sphere is a form which provides maximum surface area for absorption and interaction. In this form a cell remains at the lowest possible energy. In tissues, cells acquire different fops like polygonal, rectangular, irregular etc. Here the concern is to accommodate maximum number of cells in minimum area, so that complete functions are being taken care of.
Cilia and flagella share a common structure, with a microtubular core which has a 9+2 organization with nine paired doublets of microtubules surrounding a central pair to form the
There is no Interphase preceding second meiotic division. There is a brief intervening period called Interkinesis During this period there may be synthesis of some reserve fo
Why are the recombinant DNA technology and the nucleus transplantation technology still dangerous? The recombinant DNA technology and the nucleus transplantation technology (cl
Matthew Meselson and Frank Stahl grew bacteria in media having either N14 or N15 for various numbers of cell divisions. DNA from the bacterial samples were isolated and spun within
Technique : The suitability of the pulmonary autograft for aortic valve replacement has to be studied by accurate measurement by echocardiogram of the aortic and pulmonary annuli.
Q. How does the poison cyanide act upon the aerobic respiration? Cyanide is a poison that restrains the last cytochrome of the respiratory chain, interrupting the ATP formation
Occlusal load affect Osseointegration The timing and amount of overload are critical for osseointegration. Occlusal loading early, where the primary stability is low leads to h
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Explain the Observation or Inference for seliwanoff's test? 1. Wine or cherry red colour seen. Wine red colour confirms the presence of a ketose sugar. Note: On overheating
Describe Oxidative Stress in New Cardio-vascular Risk Factors ? In the risk conferred by LDL cholesterol, the oxidative modification of LDL plays a central role, because it is
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd