Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The stabilization energy of a bond or interatomic interaction is the change in energy upon breakage of a bond between two atoms (i.e., the change in energy when the atoms are moved away from each other). We can classify bonds into the following categories, based on their dissociation energies:
Strong: > 300 kJ mol-1
Medium: 20-200 kJ mol-1
Weak: 5-20 kJ mol-1
Very weak: 0-5 kJ mol-1
Consider the bonds highlighted in gray in the diagram below.
a. First consider the bonds in molecules isolated from all other molecules (in a vacuum). Classify each of them into the four categories given above, based on your estimation of the bond strength.
b. Which of these bonds could be broken readily by thermal fluctuations?
c. Next, consider what happens when these molecules are immersed in water (fully solvated). For each bond, indicate whether it becomes weaker, stronger, or stays the same in water.
d. Which of these bonds could be broken readily by thermal fluctuations in water?
Q. Dietary Recommendations during Diarrhoea? The diet should take into account the normal RDI and various adjustments made to the quantity and quality of the foods to be given.
Ask question #Minimum 100 words adccepted#
What is the formula of the net primary production (NPP)? How does NPP relate to the energy pyramids? Net primary production is the gross main productivity less the organic mate
Compare and contrast the effect of a deletion in the operator of the lactose operon with one in the operator of the histidine operon.
The several types of steam sterilizers that are in use. 1. Lab Autoclave 2. Hospital dressing sterilizer 3. Bowl & instrument sterilizer 4. Rapid cooling sterilizer
Bone Modeling It is a surface-specific activity (apposition or resorption) that produces a net change in the size and/or shape of a bone after initial bone formation in the emb
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Define Nutritional Support Management for pancreatic cancer? When there is deficiency of exocrine pancreatic secretions, adequate amounts of pancreatic extract are helpful. It
Biotolerant Metals :- Co- Cr Alloys, Stainless Steel, Gold, niobium, tantalum Polymers:- Polyethylene, polytetrafluorethylene, polyamide, polymethylmethacrylate, polyureth
All of us must have suffered from diarrhoea at least once in our lifetime. How do you feel thereafter? Well most of us must have experienced weakness, dizziness, dryness of mouth a
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd