Theory of embryology -recapitulation theory / biogenetic law, Biology

Assignment Help:

RECAPITULATION THEORY / BIOGENETIC LAW

It was proposed by Muller & Haeckel on the basis of Baer's law.

According to it, in the development of animal phylum characters are formed first & species characters are formed in the last.

Hackel proposed recapitulation theory & explained that 'ontogeny repeats phylogeny' i.e. ontogenic development of the animal repeats the evolutionary history of the animal.

"Ontogeny repeats Phylogeny" -

887_biogenetic law.png

Induction of metamorphosis started by thiourea


Related Discussions:- Theory of embryology -recapitulation theory / biogenetic law

Roots have no chlorophyll and grow in darkness, Roots have no chlorophyll a...

Roots have no chlorophyll and grow in darkness. So how do roots obtain their food? Food made in the leaves is transported to the roots in the phloem of the vascular bundles.

#title.how can help me solve this problem?, i have a question on how to pro...

i have a question on how to proceed the fomular of delete the gene on the human body.

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Determine the reliability of the battery, Determine the reliability of the ...

Determine the reliability of the battery The issue of reliability of the battery has been addressed, with reasonably successful results. Clinical interpretation of the battery

Explain the control of air pollution, Explain the Control of Air Pollution ...

Explain the Control of Air Pollution a. Air belongs to everyone Need it to treat air pollution as public problem   b. Air pollution is an inevitable concomitan

What is the name of the dna duplication process, What is the name of the DN...

What is the name of the DNA duplication process? What is the main enzyme that participates in it? The process of copying, or duplication, of the DNA molecule is called replica

Explain monomeric enzymes, Monomeric enzymes Monomeric enzymes are thos...

Monomeric enzymes Monomeric enzymes are those which consist of only a single polypeptide chain, so they cannot be dissociated into smaller units. Very few monomeric enzymes are

What is the stage of cellular respiration, What is the stage of cellular re...

What is the stage of cellular respiration during which carbon dioxide is liberated? In aerobic cellular respiration the release of carbon dioxide occurs in the transformation o

Explain phosphofiuctokinase-i, Phosphofiuctokinase-I Phosphofiuctokina...

Phosphofiuctokinase-I Phosphofiuctokinase-I  is activated by AMP and  inhibited by ATP and citrate. When ATP is utilized in energy requiring process, the concentration ofAMP

State about osteogenesis, State about osteogenesis Embryologically, ost...

State about osteogenesis Embryologically, osteogenesis may be classified as either intramembranous or endochondral. When the ossification occurs directly, it is defined as intr

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd