Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
RECAPITULATION THEORY / BIOGENETIC LAW
It was proposed by Muller & Haeckel on the basis of Baer's law.
According to it, in the development of animal phylum characters are formed first & species characters are formed in the last.
Hackel proposed recapitulation theory & explained that 'ontogeny repeats phylogeny' i.e. ontogenic development of the animal repeats the evolutionary history of the animal.
"Ontogeny repeats Phylogeny" -
Induction of metamorphosis started by thiourea
Roots have no chlorophyll and grow in darkness. So how do roots obtain their food? Food made in the leaves is transported to the roots in the phloem of the vascular bundles.
i have a question on how to proceed the fomular of delete the gene on the human body.
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Determine the reliability of the battery The issue of reliability of the battery has been addressed, with reasonably successful results. Clinical interpretation of the battery
Explain the Control of Air Pollution a. Air belongs to everyone Need it to treat air pollution as public problem b. Air pollution is an inevitable concomitan
What is the name of the DNA duplication process? What is the main enzyme that participates in it? The process of copying, or duplication, of the DNA molecule is called replica
Monomeric enzymes Monomeric enzymes are those which consist of only a single polypeptide chain, so they cannot be dissociated into smaller units. Very few monomeric enzymes are
What is the stage of cellular respiration during which carbon dioxide is liberated? In aerobic cellular respiration the release of carbon dioxide occurs in the transformation o
Phosphofiuctokinase-I Phosphofiuctokinase-I is activated by AMP and inhibited by ATP and citrate. When ATP is utilized in energy requiring process, the concentration ofAMP
State about osteogenesis Embryologically, osteogenesis may be classified as either intramembranous or endochondral. When the ossification occurs directly, it is defined as intr
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +1-415-670-9521
Phone: +1-415-670-9521
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd