the cell, Biology

Assignment Help:
how does autophagy help in converting a tadpole larva into an adult amphibian

Related Discussions:- the cell

Chemical stress - mineral composition, Chemical Stress - Mineral compositio...

Chemical Stress - Mineral composition The living systems make use of several mineral ions that they might have encountered at the very origin or during evolution, particularly

Can you explain ventricular tachycardia, Q. Can you explain Ventricular Tac...

Q. Can you explain Ventricular Tachycardia? The term is usually reserved for at least four or more beats and modified by the term non sustained. Short runs of non-sustained VT

Non-rapid-eye-movement sleep, Stage 1 sleep: As an individual becomes drows...

Stage 1 sleep: As an individual becomes drowsy, and enters stage 1, alpha wave decreases and theta waves appear. Theta waves with a frequency of about 6 to 8 cycles per second are

Quick transient responses - behaviour of plants, Quick transient responses ...

Quick transient responses - Behaviour of Plants Such responses are stimulated by factors showing significant variations over relatively small time period e.g., those showing w

Functions of respiratory pigments, Functions of Respiratory Pigments A...

Functions of Respiratory Pigments As you have learnt in the preceding sub-sections, the pigments are the carrier of oxygen. In the nonexistence of respiratory pigments the blo

Explain tools of satellite dna, Satellite DNA is useful tool in: 1. Org...

Satellite DNA is useful tool in: 1. Organ transplantation 2. Sex determination 3. Forensic science 4. Genetic engineering Forensic science

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Methods of gene transfer in transgenic animals, M e thods of gene transfe...

M e thods of gene transfer The technology employed for introduction of transgenes into a livestock population may produce consequences specific to the method. Once introduced

After the blastula stage what is the next stage, Q. After the blastula stag...

Q. After the blastula stage what is the following stage of the embryonic development? What is the passage from blastula to the next stage called? The blastula turns into gastru

What essential function do they serve, Why do membranes figure so prominent...

Why do membranes figure so prominently in eukaryotic cells? What essential function do they serve?

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd