Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
S-Adenosyl methionine serve as a donor of methyl sets in numerous biological reactions instance for in the formation of creatine phosphate and in the synthesis of nucleic acids. It is formed by the action of the activated methyl cycle. In during donation of its methyl group to another compound, S-adenosyl methionine is altered into S-adenosyl homocysteine. To reproduce S-adenosyl methionine, the adenosyl group is deleted from the S- adenosyl homocysteine to form homocysteine. This is then methylated by the enzyme homocysteine methyltransferase, only two vitamin B12- holding enzymes found in eukaryotes, to form methionine. The concluded methionine is then activated to S-adenosyl methionine with the release of all three of the phosphates from ATP.
What is the coelom? To which structures do coeloms give birth? Are all animals coelomate? Coeloms are cavities delimited by mesoderm. Coeloms create the cavities where the inte
Functions of Testis The testis performs the following two functions: Proliferation of spermatozoa and Secretion of steroid hormones
describe food procurement and digestion in ciliates.
Q. Is it expected that a change in the primary, in the secondary or in the tertiary structure of a protein will produce furthermore functional consequences? Any change of the p
Briefly explain about the Flexed-arm Hang Test? Persons who cannot do one pull-up may do the flexed-arm hang. Using the same hand position as in pull-ups, subject takes flexed-
A dominant allele will always increase in frequency over time. Yes No Q44. When a gene has two alleles, the allele frequencies in a population automatically move toward an equilibr
Explain the OBJECTIVES of history of mart disease? After reading this unit, you should be able to: 1. Understand the importance of Cardio-vascular diseases as the leading cause
What is the endocrine function of the placenta? The placenta besides being the organ by which the exchange of substances among the mother and the fetus is done also has the fun
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd