The activated methyl cycle, Biology

Assignment Help:

S-Adenosyl   methionine   serve  as  a  donor  of  methyl  sets  in  numerous biological  reactions instance for in the formation  of creatine phosphate and in the synthesis of nucleic acids. It is formed by the action of the activated methyl cycle. In during donation of its methyl group to another compound, S-adenosyl methionine is altered into S-adenosyl homocysteine.  To reproduce S-adenosyl   methionine,   the adenosyl   group   is deleted   from the S- adenosyl  homocysteine  to form  homocysteine.  This is then methylated by the enzyme   homocysteine    methyltransferase,   only   two   vitamin   B12- holding enzymes found in eukaryotes, to form methionine. The concluded methionine is then activated to S-adenosyl methionine with the release of all three of the phosphates from ATP.

497_22.png


Related Discussions:- The activated methyl cycle

What is the coelom, What is the coelom? To which structures do coeloms give...

What is the coelom? To which structures do coeloms give birth? Are all animals coelomate? Coeloms are cavities delimited by mesoderm. Coeloms create the cavities where the inte

Functions of testis, Functions of Testis The testis performs the follo...

Functions of Testis The testis performs the following two functions: Proliferation of spermatozoa and Secretion of steroid hormones

Assigment, describe food procurement and digestion in ciliates.

describe food procurement and digestion in ciliates.

Change in structure of a protein, Q. Is it expected that a change in the pr...

Q. Is it expected that a change in the primary, in the secondary or in the tertiary structure of a protein will produce furthermore functional consequences? Any change of the p

Briefly explain about the flexed-arm hang test, Briefly explain about the F...

Briefly explain about the Flexed-arm Hang Test? Persons who cannot do one pull-up may do the flexed-arm hang. Using the same hand position as in pull-ups, subject takes flexed-

How the allele frequencies in a population, A dominant allele will always i...

A dominant allele will always increase in frequency over time. Yes No Q44. When a gene has two alleles, the allele frequencies in a population automatically move toward an equilibr

Explain the objectives of history of mart disease, Explain the OBJECTIVES o...

Explain the OBJECTIVES of history of mart disease? After reading this unit, you should be able to: 1. Understand the importance of Cardio-vascular diseases as the leading cause

What is the endocrine function of the placenta, What is the endocrine funct...

What is the endocrine function of the placenta? The placenta besides being the organ by which the exchange of substances among the mother and the fetus is done also has the fun

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Community-based health insurance systems, Normal 0 false fals...

Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd