Tetanus, Biology

Assignment Help:


Tetanus


This is an infectious, non-febrile disease of animals and man, and is characterised by spasmodic tetany and hyperaesthesia. The causative agent is Clostridium tetani, a rod-shaped anaerobe with rounded ends. It forms a terminal spore, which is twice the width of micro-organism and gives an appearance similar to drumstick. The spores are highly resistant and withstand desiccation indefinitely and 5% phenol for 15 hours. The micro-organism produces a highly potent toxin which results in disease and death.


Transmission: Infection takes place by contamination of wounds. Deep punctured wounds provide favourable conditions for the spores to germinate, multiply and produce toxin which is subsequently absorbed in the animal body. The micro-organism is present in soil and in animal faeces, and is carried into the wound by a penetrating object. The organism is present in the intestine of normal animals, and under some undetermined conditions multiplies rapidly and produces toxin in sufficient quantities to be absorbed and cause the disease.


Symptoms:
The incubation period is generally 1-2 weeks but it may be as short as 3 days. Tetanus affects many species of domesticated animals but occurs particularly in horses and lambs, less frequently in adult sheep, goats, cattle, pigs, dogs and cats, and rarely in poultry. Sometimes the disease develops after a history of wound, surgical interference, shearing, docking or even injection. The initial symptoms are mild stiffness and an unwillingness to move in all the animals. More severe symptoms develop after 12-24 hours which are stiffness of limbs, neck, head, tail and twitching of muscles.The spasms develop in response to noise. In terminal stages ears are erect, nostrils dilated, nictitating membrane protruded. Mastication becomes very difficult because mouth cannot be opened, hence the name lockjaw. Human beings are also highly susceptible.


Lesions: There are no characteristic lesions but sometimes aspiration pneumonia  is seen in a few animals.


Diagnosis: The diagnosis is usually reached from the characteristic symptoms and isolation of organism from the wounds. No characteristic lesions develop which can be observed on post-mortem examination.


Treatment: In cattle the chances of recovery with treatment are better than in horses or sheep. The treatment is carried out by first injecting antitoxin [1 million international unit (I.U.) for a horse] then treating the wound. Penicillin given parenterally is beneficial. Muscular relaxation is achieved by injection of relaxants. The animal should be kept in a dark room and fed with the help of stomach tube.


Control: Proper hygiene and cleanliness at castration and other surgical procedures should be observed. Active immunization of horses with alum-precipitated toxoid has proved to be of value. Usually 2-3 injections are to be given. Annual vaccination thereafter is valuable in enzootic areas. Sheep should be given two injections three weeks apart to develop a solid immunity.


Related Discussions:- Tetanus

What do you mean by connective tissue proper, Q. What is connective tissue ...

Q. What is connective tissue proper? The name connective tissue proper is used to designate the connective tissue that fills interstitial spaces as opposed to the specialized c

What is the difference between disaccharides, Q. What is the difference bet...

Q. What is the difference between disaccharides and monosaccharides? What are some examples of monosaccharides and of disaccharides that form them? Monosaccharides are simple m

Multiplication phas - stages of spermatogenesis, Multiplication Phas - Stag...

Multiplication Phas - Stages of spermatogenesis The initial cells in the germ line arc known as primordial germ cells (PCC). The PGC, which arise at some distance from the pro

Cause the inhibition of apoptosis, We now understand that mutations that ca...

We now understand that mutations that cause the inhibition of apoptosis are found in tumors. Because proliferation itself is not induced by the inhibition of apoptosis, explain how

Define changes associated with the skeletal system - ageing, Define Changes...

Define Changes associated with the skeletal system - Ageing? Skeletal bone loss occurs with ageing and may have serious consequences among the elderly. With ageing, there is so

#protozoa, #what is the habitat of phylum protozoa

#what is the habitat of phylum protozoa

What is smooth muscle, What is Smooth Muscle? Smooth muscle provides th...

What is Smooth Muscle? Smooth muscle provides the contractile force for movement in internal organs under control of the involuntary or autonomic nervous system. Smooth muscle

Main prophylactic measures against hookworm disease, Q. What are the main p...

Q. What are the main prophylactic measures against hookworm disease? The major prophylactic measures against hookworm disease are to avoid walking barefoot on soils suspected o

Discovery of the cell, Q. Describe the Discovery of the Cell? Ans: The ...

Q. Describe the Discovery of the Cell? Ans: The discovery that living organisms are composed of cells was made by an Englishman, Robert Hooke, in 1665. Hooke used the light mic

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd