Temperate shrublands, Biology

Assignment Help:

These are areas where woody shrubs predominate rather then trees. In regions with a Mediterranean type of climate i .e., hot dry summers and cool wet winters, shrubs grow close together having typically leathery leaves. Remarkably similar shrublands are found in the coastal mountains of California in USA and in Chile; at the tip of Africa and south western Australia. However, in USA such communities are called chaparral. Fires are of common occurence and plants and animals have developed adaptations to these special habitat features.


Related Discussions:- Temperate shrublands

Transcription and processing of prokaryotic rrna, In E.  coli  there  are  ...

In E.  coli  there  are  seven  rRNA  transcription  units  scattered  by  the genome,  each of that contains one copy of every of the 16S, 23S  and 5S rRNA genes and one to four c

Structure and function of lipoproteins, Triacylglycerols, cholesterol and p...

Triacylglycerols, cholesterol and phospholipids are associatively insoluble in aqueous solution. Thus, they are transported around the body in the blood as parts of lipoproteins.

Explain gametophyte, "In these autotrophs, sporophyte is the dominant gener...

"In these autotrophs, sporophyte is the dominant generation. Gametophyte is also photosynthetic and not dependent on sporophyte for nutrition."  These autotrophs are:  a.  P

Limnology, Limnology : It is the study of organisms present in rivers or fr...

Limnology : It is the study of organisms present in rivers or fresh water lakes. Limnology is also called as freshwater science. This is the study of inland waters. Limnology is of

What do you mean by hemichordata, Q. What do you mean by Hemichordata ? ...

Q. What do you mean by Hemichordata ? Hemichordates re vermiform (worm-like) animals which have few characters like those of the chordates, hence the name hemichordata (hemi :

Mechanoreceptors - receptors, Mechanoreceptors - Receptors Mechanorece...

Mechanoreceptors - Receptors Mechanoreceptors involve those receptors involved in perception of touch, pressure, tension, hearing, vibration, gravity, muscle tension etc. Th

What is mass transportation across the cell membrane, Mass transportation i...

Mass transportation is the access or the exiting of substances in or from the cell engulfed by portions of membrane. The fusion of internal substance-having membranous vesicles wit

Show technical aspects of the postero-anterior film, Q. Show technical aspe...

Q. Show technical aspects of the postero-anterior film? 1) Identification: Patient identification and side marker must be present. 2) Centering: The thoracic spinous pro

Explain iron uptake by cells, Explain Iron Uptake by Cells? Iron partic...

Explain Iron Uptake by Cells? Iron participates in a large number of biochemical reactions. However, for iron to perform any function, it first needs to be taken up by the cell

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd