Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
These are areas where woody shrubs predominate rather then trees. In regions with a Mediterranean type of climate i .e., hot dry summers and cool wet winters, shrubs grow close together having typically leathery leaves. Remarkably similar shrublands are found in the coastal mountains of California in USA and in Chile; at the tip of Africa and south western Australia. However, in USA such communities are called chaparral. Fires are of common occurence and plants and animals have developed adaptations to these special habitat features.
In E. coli there are seven rRNA transcription units scattered by the genome, each of that contains one copy of every of the 16S, 23S and 5S rRNA genes and one to four c
Triacylglycerols, cholesterol and phospholipids are associatively insoluble in aqueous solution. Thus, they are transported around the body in the blood as parts of lipoproteins.
"In these autotrophs, sporophyte is the dominant generation. Gametophyte is also photosynthetic and not dependent on sporophyte for nutrition." These autotrophs are: a. P
Limnology : It is the study of organisms present in rivers or fresh water lakes. Limnology is also called as freshwater science. This is the study of inland waters. Limnology is of
Q. What do you mean by Hemichordata ? Hemichordates re vermiform (worm-like) animals which have few characters like those of the chordates, hence the name hemichordata (hemi :
Mechanoreceptors - Receptors Mechanoreceptors involve those receptors involved in perception of touch, pressure, tension, hearing, vibration, gravity, muscle tension etc. Th
Mass transportation is the access or the exiting of substances in or from the cell engulfed by portions of membrane. The fusion of internal substance-having membranous vesicles wit
Q. Show technical aspects of the postero-anterior film? 1) Identification: Patient identification and side marker must be present. 2) Centering: The thoracic spinous pro
Explain Iron Uptake by Cells? Iron participates in a large number of biochemical reactions. However, for iron to perform any function, it first needs to be taken up by the cell
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd