Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Temperate rain forests - Ecosystem
The temperate rain Forests are colder than any other rain forest and exhibit a marked seasonality with regard to temperature and rainfall. Rainfall is high, but fog may be very heavy which may actually represent a more important source of water than rainfall itself. The biotic diversity of temperate forests is high as compared to temperate forest.
However, the diversity of plant and animals is much low as compared to their warmer counterparts. The animals of temperate rain forests are similar to those of deciduous forests, but show a somewhat high diversity.
Advantages (1) Liquid and gaseous fuels can be manufactured from solid fuels. (2) Relatively cheap and easily available. (3) These are easy to transport. (4) A
What is the vector of malaria? How different is its behavior from the behavior of the vector of dengue fever? The vector of malaria is a mosquito of the genus Anopheles, also k
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
How is retaining structure used? A retaining wall helps in maintaining the surface of the ground at different elevations on either side of the structure. If the retaining wall
Q. In sickle cell anemia, a hereditary disease, there is replacement of one amino acid by another in one of the four polypeptide chains of hemoglobin. In this case are all of the s
Genetic Defect in Pyruvate Dehydrogenase A defed in any of the protein subunits of PDH can result in decrease or complete loss of activity. Severe cases are usually fatal. Sy
Sertoli cells are found in: 1. ovaries and secrete progesterone 2. adrenal cortex and secrete adrenaline 3. seminiferous tubules and provide nutrition to germ cells 4.
All of us must have suffered from diarrhoea at least once in our lifetime. How do you feel thereafter? Well most of us must have experienced weakness, dizziness, dryness of mouth a
Why is the determination of the blood types of the donor and of the recipient important in transfusions? Red blood cells have dissimilar antigens in the outer surface of their
How dissimilar are the endosperm of gymnosperms and the endosperm of angiosperms? In the gymnosperms the endosperm is haploid (n), it is called as primary endosperm. In the ang
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd