Temperate rain forests - ecosystem, Biology

Assignment Help:

Temperate rain forests - Ecosystem

The temperate rain Forests are colder than any other rain forest and exhibit a marked seasonality with regard to temperature and rainfall. Rainfall is high, but fog may be very heavy which may actually represent a more important source of water than rainfall itself. The biotic diversity of temperate forests is high as compared to temperate forest.

However, the diversity of plant and animals is much low as compared to their warmer counterparts. The animals of temperate rain forests are similar to those of deciduous forests, but show a somewhat high diversity.


Related Discussions:- Temperate rain forests - ecosystem

Sucession, what is the model of tolerence mpdel of sucession

what is the model of tolerence mpdel of sucession

What is the mechanism of elisa, ELIZA stands for enzyme linked immune diffu...

ELIZA stands for enzyme linked immune diffusion assays. It works on standard of antigen antibody reaction.

Need for a transport system, Need for a transport system: Transport ...

Need for a transport system: Transport system is essential to keep the cells alive and healthy Failure of these transport systems would result in diseases Cells requir

Explain process of glycosylation, Glycosylation: The covalent addition of ...

Glycosylation: The covalent addition of the sugar moities to N or O atoms present in the side chains of various amino acids of certain proteins, usually occuring within the Golgi

Conduits-surgery for coronary artery disease, Conduits Figure: Ve...

Conduits Figure: Venous Conduits Reversed saphenous vein was the first conduit used for CABG. 'It is usually harvested from the leg starting above the ankle going up

What is the basic morphology of a protozoan cell, What is the basic morphol...

What is the basic morphology of a protozoan cell? Protozoans are eukaryotic cells so they have organelles and structures common to this part of cell: endoplasmic reticula, Gol

Define historical example of ecosystems science, Define Historical example ...

Define Historical example of Ecosystems Science? Mathematical and statistical tools are central to enhancing our understanding of large-scale systems and contain, for instance,

Dna replication, DNA Replication Deoxyribonucleic acid (DNA) is the car...

DNA Replication Deoxyribonucleic acid (DNA) is the carrier of genetic data for all living creatures. An organism's genome, made of DNA, encodes the genetic blueprint for buildi

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd