Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Q. Habitat for the worlds species? Natural ecosystems provide habitat for the world's species. Forests, coral reefs and deep ocean bottoms house many species. Wetlands, through
What is the difference between bryophytes and tracheophytes? Bryophytes are nonvascular plants (mosses, hornworts, liverworts), i.e., they do not have a conductive system for t
How do you explain in the absence of aldehyde group in the pentaacetate of D-glucose? Ans) when you react glucose with acetic anhydrate it forms pentaacetate with 5 OH grops it tel
how is biotechnology useful?
Explain the Meaning of Transfer of Culture Transfer of culture can be done from one liquid media to another liquid media or from liquid to solid media or vice versa. The steps
What is Implant Failure Implant Failure : The total failure of implant to fulfil its purpose which are49 Surgical Complications, Long Term Implant Failures and Ma
Trypsin Trypsin is secreted in the inactive form trypsinor - which is converted into the active form trypsin by the enzyme enterokinase secrated by the duodenal mucosa.
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Members belonging to different species refrain from mating because of the behavioural differences between them. Such behavioural differences usually centre around specific courtshi
Q. What is the incubation period of an infection? The Incubation period is the time interval between the infection by an agent that causes disease and the first signs or sympto
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd