Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Q. How are the epithelial tissues classified? The epithelial tissues are classified according to the shape of the cells that form it epithelial cells may be columnar, cuboidal,
Q. What is the chorioallantois membrane present in the embryonic development of birds and reptiles? How does this membrane participate in the energetic metabolism of the embryo?
Carbomedics Valve : Almost similar to StJude Medical valve, his is a low profile bileaflet valve made of pyrolitic carbon. On echo cardiography four small jets of regurg
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
What is vernalisation? How is the process of vernalisation benefits to plants?
Define Carbohydrate Metabolism of manganese? Mn is required for carbohydrate metabolism. Enzymes pyruvate carboxylase and phosphoenol pyruvate carboxy kinase involved in glucon
Explain Water as a lubricant? All fluids have lubricating as they can make it easier for the solid materials to slip over one another. Water-based fluids act as lubricants in
How Low Birth Weight cause Protein Energy Malnutrition? The beginning of PEM in children starts in US from the time of their birth. At least a third of the Indian children are
Determine the Human Energy Requirements? This unit focuses on the human energy requirements. The nutrient requirement for Indian population, you may recall studying in the last
A dialogue and cartoon between haemoglobin and chlorophyll
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd