Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Q. Do echinoderms present external or internal fecundation? Is there sex division among individuals? The fecundation in echinoderms is external, gametes are liberated in water
Cell Interactions and Ooplasmic Determinants Microscopic observations of egg cytoplasm suggests that it is not homogenous in appearance. The observable variations in the cytop
What are risk factors for diseases? Risk factors for a disease are everything that contributes to enhance the risk of the disease to appear. For instance, for most cardiovascul
Electric Charge - Properties of Colloidal Systems Colloidal particles are electrically charged. Some colloidal particles carry a positive charge (+), others a negative charge (
Post pa r turient haemoglobinuria It is also known as puerperal haemoglobinuria or nutritional haemoglobinurea and results in intravascular haemolysis, haemoglobinuria and a
difference between protonephridia and metanephridia
Xylem transfer cells The lateral transport of ions from root xylem to leaves probably takes place via xylem transfer cells which have two special features: The ce
What is the main difference between a bird heart and a mammalian heart? The bird heart has a one aortic arch on the right side of its body while the mammalian heart has one on
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
what is the classification of protozoa
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd