taxol, Biology

Assignment Help:
Paclitaxel is a anticancer drug. It stabilizes microtubules and as a result, interferes with the normal breakdown of microtubules (you will know about microtubules in future lectures).The structure of the Paclitaxel is given below

How many C, N, H and O atoms in paclitaxel
Label in the picture the hydrophobic part of paclitaxel
Label in the picture where it can make hydrogen bonds
Is this molecule is water soluble ? lipophilic ? both ? Explain
Can it form covalent bond ? Ionic bond?ion

Related Discussions:- taxol

Do echinoderms present external or internal fecundation, Q. Do echinoderms ...

Q. Do echinoderms present external or internal fecundation? Is there sex division among individuals? The fecundation in echinoderms is external, gametes are liberated in water

Cell interactions and ooplasmic determinants, Cell Interactions and Ooplasm...

Cell Interactions and Ooplasmic Determinants Microscopic observations of egg cytoplasm suggests that it is not homogenous in appearance. The observable variations in the cytop

What are risk factors for diseases, What are risk factors for diseases? ...

What are risk factors for diseases? Risk factors for a disease are everything that contributes to enhance the risk of the disease to appear. For instance, for most cardiovascul

Explain properties of colloidal systems - electric charge, Electric Charge ...

Electric Charge - Properties of Colloidal Systems Colloidal particles are electrically charged. Some colloidal particles carry a positive charge (+), others a negative charge (

Postparturient haemoglobinuria, Post pa r turient haemoglobinuria It...

Post pa r turient haemoglobinuria It is also known as puerperal haemoglobinuria or nutritional haemoglobinurea and results in intravascular haemolysis, haemoglobinuria and a

Differnces, difference between protonephridia and metanephridia

difference between protonephridia and metanephridia

Xylem transfer cells, Xylem transfer cells The lateral transport of io...

Xylem transfer cells The lateral transport of ions from root xylem to leaves probably takes place via xylem transfer cells which have two special features: The ce

Difference between a bird heart and a mammalian heart, What is the main dif...

What is the main difference between a bird heart and a mammalian heart? The bird heart has a one aortic arch on the right side of its body while the mammalian heart has one on

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Protozoa, what is the classification of protozoa

what is the classification of protozoa

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd