Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Neurotransmitters
We know that transmission of signals from nerves to muscles is affected by acetylcholine a transmitter substance. Similarly neuron-neuron transmission is also achieved by acetylcholine. But there are several other chemicals that function as neurotransmitters. A limited number has already been identified and new ones are being identified rapidly.
A chemical can be called a neurotransmitter in a given tissue only if it fulfils certain conditions like:
Clinical Manifestation Early onset of dyspnea on exertion (DOE) which progresses to continuous dyspnea. Rhonchi, crackles , accessory muscle breathing, Increased rate of br
Sex Determination - Reproduction Sex, whether an individual will be a male or a female is determined at fertilisation, and this directs and controls all the later processes i
Define the Fats requirement to avoid underweight problem? We know that fats are concentrated source of energy (1g = 9 Kcals). Fats are capable of increasing the energy val
State the term - Halsted Reitan varies with the particular test Scoring for the Halsted Reitan varies with the particular test, such that individual scores may be expressed in
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Nutritional care can be recognized as both a science and art. Can you tell why? It is considered as a science because the raped advances in scientific knowledge provides all h
how nematodes adapted to their mode of feedings
Q. What is QT Dispersion? Is the difference between the QT interval measured from one part of the heart and the QT interval measured from another part of the heart. The QT inte
GOLGI COMPLEX ( GOLGI APPARATUS = GOLGI BODY) The Nobel laureate, Camilla Golgi (1898) discovered the presence of a special, small group of interconnecting membranous s
Stomata can open and close in response to changes in the CO 2 concentration inside the leaf. Would you expect stomata to open or close if the CO 2 concentration decreased? Explai
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd