Sympatric speciation, Biology

Assignment Help:

Sympatric speciation can be regarded as speciation where parent species gives rise to a daughter species without the individuals of a species being separated by space or territory. Both instantaneous and gradual models of sympatric speciation have been proposed. Barring one mode of instantaneous speciation by a mechanism known as polyploidy, other modes of sympatric speciation have remained quite controversial. Polyploidy is quite common among plants. (For a detailed discussion on polyploidy refer to Unit 10 of Block 2 of LSE-03 of Genetics course). A cross between two diploid plants could result in a tetraploid hybrid. The hybrid would remain largely reproductively isolated from its diploid parents. The reason for such isolation is that due to back-crossing if a triploid individual were to be formed, it will produce a high proportion of nonviable gametes. There is also a possibility that interbreeding between deploid and tetraploid forms or between different tetraploids may give rise to other polyploids.


Related Discussions:- Sympatric speciation

Name the various suturing techniques, Name the various suturing techniques ...

Name the various suturing techniques There are a various suturing techniques each suited for a particular situation. Few of the common suturing techniques are mentioned here

Define hepatopoietic and immune system - geriatric nutrition, Define Hepato...

Define Hepatopoietic and immune System - geriatric nutrition? Though the circulating red blood cells or the white cell count or platelet number does not normally change with a

Explain homologous and heterologous immunoglobulins, What is the difference...

What is the difference between homologous and heterologous immunoglobulins? Homologous immunoglobulin is the human (from the similar species) immunoglobulin. In case of inocula

Visualize patient ductus arteriosus, Q. Visualize Patient Ductus Arteriosus...

Q. Visualize Patient Ductus Arteriosus? Best view to visualize a patient ductus arteriosus is high parasternal or ductal view. A patient ductus arteriosus in this view is see

Define changes in tract minerals - nutrition during stress, Define Changes ...

Define Changes in Tract Minerals - Nutrition during Stress? Changes in the balance of magnesium, phosphate, zinc and potassium follows alterations in nitrogen balance. Iron and

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Types of disease, TYPES OF DISEASE    ...

TYPES OF DISEASE     communicable Caused by infective agents disease

Fructose-1, Fructose-1,6-bisphosphate  and Fructose-6-phosphate : The  conv...

Fructose-1,6-bisphosphate  and Fructose-6-phosphate : The  conversion of  fructose-1,6- bisphosphate  to fructose-6-phosphate is  catalysed by fluctose-1,6-bisphosphatase  which  i

Deficiency diseases-evaluation of production diseases, Evaluation of produc...

Evaluation of production diseases Generally, production diseases are acute states and respond dramatically to administration of a deficient nutrient or metabolite. The nutriti

Leghaemoglobin - factors influencing functions of nitrogenas, Leghaemoglobi...

Leghaemoglobin - Factors Influencing Functions of Nitrogenase Leghaemoglobin is a joint product of Rhizobium and the host. It is produced during the maturation of nodule. It i

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd