Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Sympatric speciation can be regarded as speciation where parent species gives rise to a daughter species without the individuals of a species being separated by space or territory. Both instantaneous and gradual models of sympatric speciation have been proposed. Barring one mode of instantaneous speciation by a mechanism known as polyploidy, other modes of sympatric speciation have remained quite controversial. Polyploidy is quite common among plants. (For a detailed discussion on polyploidy refer to Unit 10 of Block 2 of LSE-03 of Genetics course). A cross between two diploid plants could result in a tetraploid hybrid. The hybrid would remain largely reproductively isolated from its diploid parents. The reason for such isolation is that due to back-crossing if a triploid individual were to be formed, it will produce a high proportion of nonviable gametes. There is also a possibility that interbreeding between deploid and tetraploid forms or between different tetraploids may give rise to other polyploids.
In order to be able to study the neural basis of perceptual and cognitive functions, it is necessary to have some knowledge of brain anatomy (i.e., what the names of different brai
Producers - Biotic Components Producers also called autotrophs are largely green plants that can make food from simple inorganic materials. Food refers to complex organic comp
WHAT ARE THE ADVANTAGES & THE DISADVANTAGES OF PROTOZOA?
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Q. How does digestion in beings of the phylum Annelida work and which type of digestive system do they have? Digestion in beings of the phylum Annelida is extracellular. These
What is the role of mitosis in growth?
You now know that natural seleqtion aims at evolving adaptations of organisms in response to environmental changes in the inanimate world. Also many adaptations arise due to intera
Q. What is Fenugreek seeds? Fenugreek seeds: 'Commonly known as methi seeds in Hindi. They are commonly used in Indian cuisine in chutney and even in pickles and several dishes
Define about the Anthropometry Method? Anthropometry refers to the measurement of the size and proportions of' the human body. Anthropometric prediction equations estimate body
Epidemiology The organism does not appear to be very host or tissue specific and can infect naturally a large number of avian and mammalian species. Chlamydiosis has been reco
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd