Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Sympatric speciation can be regarded as speciation where parent species gives rise to a daughter species without the individuals of a species being separated by space or territory. Both instantaneous and gradual models of sympatric speciation have been proposed. Barring one mode of instantaneous speciation by a mechanism known as polyploidy, other modes of sympatric speciation have remained quite controversial. Polyploidy is quite common among plants. (For a detailed discussion on polyploidy refer to Unit 10 of Block 2 of LSE-03 of Genetics course). A cross between two diploid plants could result in a tetraploid hybrid. The hybrid would remain largely reproductively isolated from its diploid parents. The reason for such isolation is that due to back-crossing if a triploid individual were to be formed, it will produce a high proportion of nonviable gametes. There is also a possibility that interbreeding between deploid and tetraploid forms or between different tetraploids may give rise to other polyploids.
Name the various suturing techniques There are a various suturing techniques each suited for a particular situation. Few of the common suturing techniques are mentioned here
Define Hepatopoietic and immune System - geriatric nutrition? Though the circulating red blood cells or the white cell count or platelet number does not normally change with a
What is the difference between homologous and heterologous immunoglobulins? Homologous immunoglobulin is the human (from the similar species) immunoglobulin. In case of inocula
Q. Visualize Patient Ductus Arteriosus? Best view to visualize a patient ductus arteriosus is high parasternal or ductal view. A patient ductus arteriosus in this view is see
Define Changes in Tract Minerals - Nutrition during Stress? Changes in the balance of magnesium, phosphate, zinc and potassium follows alterations in nitrogen balance. Iron and
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
TYPES OF DISEASE communicable Caused by infective agents disease
Fructose-1,6-bisphosphate and Fructose-6-phosphate : The conversion of fructose-1,6- bisphosphate to fructose-6-phosphate is catalysed by fluctose-1,6-bisphosphatase which i
Evaluation of production diseases Generally, production diseases are acute states and respond dramatically to administration of a deficient nutrient or metabolite. The nutriti
Leghaemoglobin - Factors Influencing Functions of Nitrogenase Leghaemoglobin is a joint product of Rhizobium and the host. It is produced during the maturation of nodule. It i
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd