Sympatric speciation, Biology

Assignment Help:

Sympatric speciation can be regarded as speciation where parent species gives rise to a daughter species without the individuals of a species being separated by space or territory. Both instantaneous and gradual models of sympatric speciation have been proposed. Barring one mode of instantaneous speciation by a mechanism known as polyploidy, other modes of sympatric speciation have remained quite controversial. Polyploidy is quite common among plants. (For a detailed discussion on polyploidy refer to Unit 10 of Block 2 of LSE-03 of Genetics course). A cross between two diploid plants could result in a tetraploid hybrid. The hybrid would remain largely reproductively isolated from its diploid parents. The reason for such isolation is that due to back-crossing if a triploid individual were to be formed, it will produce a high proportion of nonviable gametes. There is also a possibility that interbreeding between deploid and tetraploid forms or between different tetraploids may give rise to other polyploids.


Related Discussions:- Sympatric speciation

Anatomy of the brain, In order to be able to study the neural basis of perc...

In order to be able to study the neural basis of perceptual and cognitive functions, it is necessary to have some knowledge of brain anatomy (i.e., what the names of different brai

Producers - biotic components, Producers - Biotic Components Producers...

Producers - Biotic Components Producers also called autotrophs are largely green plants that can make food from simple inorganic materials. Food refers to complex organic comp

PROTOZOA., WHAT ARE THE ADVANTAGES & THE DISADVANTAGES OF PROTOZOA?

WHAT ARE THE ADVANTAGES & THE DISADVANTAGES OF PROTOZOA?

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

How does digestion in beings of the phylum annelida work, Q. How does diges...

Q. How does digestion in beings of the phylum Annelida work and which type of digestive system do they have? Digestion in beings of the phylum Annelida is extracellular. These

Mitosis, What is the role of mitosis in growth?

What is the role of mitosis in growth?

Predation and coevolution, You now know that natural seleqtion aims at evo...

You now know that natural seleqtion aims at evolving adaptations of organisms in response to environmental changes in the inanimate world. Also many adaptations arise due to intera

What is fenugreek seeds, Q. What is Fenugreek seeds? Fenugreek seeds: '...

Q. What is Fenugreek seeds? Fenugreek seeds: 'Commonly known as methi seeds in Hindi. They are commonly used in Indian cuisine in chutney and even in pickles and several dishes

Define about the anthropometry method, Define about the Anthropometry Metho...

Define about the Anthropometry Method? Anthropometry refers to the measurement of the size and proportions of' the human body. Anthropometric prediction equations estimate body

Chlamydiosis-epidemiology, Epidemiology The organism does not appear t...

Epidemiology The organism does not appear to be very host or tissue specific and can infect naturally a large number of avian and mammalian species. Chlamydiosis has been reco

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd