Swine fever, Biology

Assignment Help:

Swine fever

It is also known as hog cholera and results in high fever and prostration.

Etiology: Pestivirus belonging to family Togaviridae is responsible in producing the disease. The virus is resistant to common disinfectants and heating as it can survive for long periods. The disease spreads primarily by ingestion but it can spread by inhalation also. Mechanical spread of the virus is also possible.

Pathogenesis: After gaining entry, the organisms reach into tonsil and multiply after which they enter into circulation through lymphatic vessels. From there, it can reach spleen, lymph nodes and bone marrow. The virus mainly affects the endothelial, epithelial and reticular cells and macrophages. The blood vessels are occluded leading to congestion, haemorrhage and infraction. Medium and small arteries reveal thrombosis. These changes are more severe in spleen, lymph nodes, kidney and gastrointestinal tract.

Clinical signs: Peracute form of the disease occurs in piglets which die without showing symptoms. However, acute form is more common and animals show high fever, anorexia, stiffness, marked depression, prostration, reluctance to move, and tail hanging straight. Initially, animals suffer from constipation but later on they reveal diarrhoea and vomition.

In the early stage of the disease, circling, incoordination, muscle tremors and convulsions are also noticed. Later on purplish haemorrhagic patches appear on the ears and abdomen. Conjunctivitis is often present in pigs, and small necrotic areas are also noticed at the margins of ears, tail and vulvar lips.

The chronic form of the disease is caused by less virulent strain of the virus. The animals suffer from generalized weakness and reveal skin lesions like dermatitis, alopecia, deep purple colouration of abdominal skin and blotching of the ears. Such animals usually recover but may die if there is any kind of stress including repeated attacks of secondary bacterial infections with increased susceptibility.

The animals died of acute disease reveal wide spread haemorrhages in serous and mucous membranes, skin, lymph nodes and internal organs. Lymph nodes are enlarged and spleen shows infraction at the margins. In the colon, button ulcers are present which is pathognomonic of the disease. Beneath the capsule of kidney, petechial haemorrhages are found.

Diagnosis: It is diagnosed by the clinical sign and can be confirmed by postmortem examination of the dead animals. The blood examination reveals leukopenia in the early stage. Confirmation of the disease is possible by serological tests like agar gel precipitation, fluorescent antibody and ELISA tests.

It should be differentiated from salmonellosis, acute erysipelas and pasturellosis. In salmonellosis, enteritis and dyspnoea are noticed. Acute erysipelas is associated with echymotic haemorrhages and pasturellosis withy dyspnoea and painful swelling around throat area.

Treatment: There is no specific treatment as it is a viral disease. However, to reduce the secondary bacterial infections in chronic cases, use of broad-spectrum antibiotics is recommended. In acute cases, 50-100 ml of hyperimmune sera can be given in initial stages.

Control: Live vaccine @ 1 ml/dose by subcutaneous route controls the disease in both adult and unweaned animals. The annual vaccination is recommended as it gives immunity up to 1 year. The affected pigs should be separated from healthy stock quickly and slaughtered to prevent the spread of infection. Strict hygienic measures are also helpful in containing the disease.


Related Discussions:- Swine fever

Explain healthcare burden of heart diseases, Explain Healthcare Burden OF H...

Explain Healthcare Burden OF HEART DISEASES? CAD and its complications use up a substantial portion of the scarce healthcare resource of the country. It has been reported that

Explain ribosomes in eukaryotic and in prokaryotic cells, How different are...

How different are the location of ribosomes in eukaryotic and in prokaryotic cells? In prokaryotes ribosomes are create free in cytoplasm. In eukaryotic cells they can also be

Types of cardiac dopler, There are two types of Doppler examination: 1) ...

There are two types of Doppler examination: 1)  Pulse wave Doppler 2)  Continuous wave Doppler Both these modalities are necessary part of Doppler echocardiography and pro

Explain a home-made wormery, A home-made wormery A wooden box 30 cm by ...

A home-made wormery A wooden box 30 cm by 30 cm by 15 cm fitted with a glass front is beneficial for studying the habits of earth-worms. Fill the box nearly to the top with

Functional significance of this structural difference, The vertebral bodies...

The vertebral bodies are much larger in the lower back than the neck. What is the functional significance of this structural difference?

How many of each type of core histone, How many of each type of core histon...

How many of each type of core histone would it take to wrap the entire human genome into nucleosomes? How has evolution solved the problem of producing such a large number of prote

Chlorocruorins - respiratory pigments, Chlorocruorins - Respiratory Pigment...

Chlorocruorins - Respiratory Pigments These types of respiratory pigments are found in four polychaete families: Sabellidae, Serpulidae, Ampharetidae and Chlorhaemidae. The pi

Define ziehl-neelsen staining technique, Define Ziehl-Neelsen Staining Tech...

Define Ziehl-Neelsen Staining Technique? Ziehl-Neelsen staining is used for staining these bacteria. The technique was discovered first by Robert Koch during his pioneering inv

What is exocytosis, Which of the following is true for exocytosis? A. D...

Which of the following is true for exocytosis? A. During exocytosis in skeletal muscle cells, there will be release of calcium ions from intracellular vesicles in the sarcoplas

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd