Suspensor - pollen biology, Biology

Assignment Help:

Suspensor - Pollen Biology

The structure and function of suspensor have not been given adequate attention. During the last decade, however, investigations have produced noteworthy results. These include ultra structural, isoenzymatic, physiological, and in vitro experiments. A great deal of variation occurs in suspensor structure, probably modified to support the developing embryo. During 1950's and 1960's embryologists believed that it the suspensor is merely a morphological organ that pushes the embryo deeper into the more friendly environs of endosperm. This view is gaining reconsideration. The suspensor plays a more dynamic role than was hitherto assigned. The special kind of plastids present in legumes such as Pisum and Phaseolus and in Ipomoea and Tropaeolum show remarkable ultra structural changes around late heart-shaped stage of embryo.

The significance of these unusual plastids needs to be determined. Another feature of interest is the presence of wall embayments lined by plasma membrane in the suspensor cells supposed to be involved in short distance translocation of metabolites similar to transfer cells. Some experiments demonstrate the significance of presence of suspensor for proper development of the embryo. During early stages, removal of suspensor reduces embryo development but, at later stages, it has no effect. However, it is possible to replace, at least partially, the effect of suspensor loss by providing gibberellins in the culture medium. The finding is further substantiated by quantitative analysis of GA present in the suspensor and embryo proper cells. This GA has been identified as gibberellin Al. The relative concentrations of auxin in embryo proper and suspensor of Tropaeolum majus have been studied through single ion detection. The suspensor proper yields significantly higher concentrations of auxin. Likewise, in Phaseolus, the suspensor of heart-shaped embryo shows more cytokinin. However, at mid- cotyledonary stage, suspensor contains low cytokinin and the embryo seems to become autonomous for cytokinin.


Related Discussions:- Suspensor - pollen biology

Symptoms of angina pectoris, Q. Symptoms of Angina Pectoris? The pain o...

Q. Symptoms of Angina Pectoris? The pain of angina is usually over the center of the chest (below the sternum) but can be felt from epigastrum to the jaw and arms. It is brough

Evolutionary advantage of the occurrence of sperm cells, What is the evolut...

What is the evolutionary advantage of the occurrence of sperm cells and larval stage in the life cycle of sponges? The sexual reproduction in sponges, in addition to contributi

Determine the term poliomyelitis - brian diseases, Determine the term Polio...

Determine the term Poliomyelitis - Brian diseases Poliomyelitis is an acute infectious disease caused by a virus that has a special affinity for the motor neurons of the spinal

Energy transformation, ENERG Y TRANSFORMATION - During photosynthes...

ENERG Y TRANSFORMATION - During photosynthesis radiant energy is converted into chemical energy by green plants. In biluminiscent organisms .e.g glow worm, noctilluca &

Explain the regulation of breathing and blood pressure, Which is the brain ...

Which is the brain region responsible for the regulation of breathing and blood pressure? The neural regulation of breathing, blood pressure and other physiological parameters

PROTOZOA., WHAT ARE THE ADVANTAGES & THE DISADVANTAGES OF PROTOZOA?

WHAT ARE THE ADVANTAGES & THE DISADVANTAGES OF PROTOZOA?

What do you understand by chromosome behaviour, Q. What do you understand b...

Q. What do you understand by Chromosome Behaviour? When we study meiosis. we not only observe the regularity of pairing which is important' for' the fertility of the plants, we

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

What is the function of the umbilical cord, What is the function of the umb...

What is the function of the umbilical cord? The umbilical cord haves blood vessels which convey blood among the fetus and the placenta.

Rare species - wildlife, Rare Species - Wildlife These are those speci...

Rare Species - Wildlife These are those species whose numbers are few or they live in such small areas or in such unusual environments (endemics), that they could quickly disa

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd