Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Suspensor - Pollen Biology
The structure and function of suspensor have not been given adequate attention. During the last decade, however, investigations have produced noteworthy results. These include ultra structural, isoenzymatic, physiological, and in vitro experiments. A great deal of variation occurs in suspensor structure, probably modified to support the developing embryo. During 1950's and 1960's embryologists believed that it the suspensor is merely a morphological organ that pushes the embryo deeper into the more friendly environs of endosperm. This view is gaining reconsideration. The suspensor plays a more dynamic role than was hitherto assigned. The special kind of plastids present in legumes such as Pisum and Phaseolus and in Ipomoea and Tropaeolum show remarkable ultra structural changes around late heart-shaped stage of embryo.
The significance of these unusual plastids needs to be determined. Another feature of interest is the presence of wall embayments lined by plasma membrane in the suspensor cells supposed to be involved in short distance translocation of metabolites similar to transfer cells. Some experiments demonstrate the significance of presence of suspensor for proper development of the embryo. During early stages, removal of suspensor reduces embryo development but, at later stages, it has no effect. However, it is possible to replace, at least partially, the effect of suspensor loss by providing gibberellins in the culture medium. The finding is further substantiated by quantitative analysis of GA present in the suspensor and embryo proper cells. This GA has been identified as gibberellin Al. The relative concentrations of auxin in embryo proper and suspensor of Tropaeolum majus have been studied through single ion detection. The suspensor proper yields significantly higher concentrations of auxin. Likewise, in Phaseolus, the suspensor of heart-shaped embryo shows more cytokinin. However, at mid- cotyledonary stage, suspensor contains low cytokinin and the embryo seems to become autonomous for cytokinin.
Q. Symptoms of Angina Pectoris? The pain of angina is usually over the center of the chest (below the sternum) but can be felt from epigastrum to the jaw and arms. It is brough
What is the evolutionary advantage of the occurrence of sperm cells and larval stage in the life cycle of sponges? The sexual reproduction in sponges, in addition to contributi
Determine the term Poliomyelitis - Brian diseases Poliomyelitis is an acute infectious disease caused by a virus that has a special affinity for the motor neurons of the spinal
ENERG Y TRANSFORMATION - During photosynthesis radiant energy is converted into chemical energy by green plants. In biluminiscent organisms .e.g glow worm, noctilluca &
Which is the brain region responsible for the regulation of breathing and blood pressure? The neural regulation of breathing, blood pressure and other physiological parameters
WHAT ARE THE ADVANTAGES & THE DISADVANTAGES OF PROTOZOA?
Q. What do you understand by Chromosome Behaviour? When we study meiosis. we not only observe the regularity of pairing which is important' for' the fertility of the plants, we
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
What is the function of the umbilical cord? The umbilical cord haves blood vessels which convey blood among the fetus and the placenta.
Rare Species - Wildlife These are those species whose numbers are few or they live in such small areas or in such unusual environments (endemics), that they could quickly disa
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd