Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Super Cooling - Temperature Relations in Animals
Super cooling is a phenomenon where body water is allowed to cool far below 0°C without formation of ice. Glycerol is effective in lowering both the freezing point and also the super cooling point. In addition, glycerol improves the tolerance to freezing in animals that tolerate ice formation. In some animals antifreeze compounds are found. For example in the Antarctic fish Trematomous borchgrevinki the blood contains a glycoprotein that acts as an antifreeze substance.
VENOU S SYSTEM It is collecting system formed by the uniting branches as smaller and then larger veins and venacava leading to the heart. Blood from anterior part of the
True or false? It would be difficult to assess whether the drug-susceptible or drug-resistant phenotype in a population of Mycobacterium tuberculosis was more fit in an environment
Q. What are the Pseudo-yeasts? These are like true yeasts but do not form spores. All the members of this group are particularly unsuitable for fermentation purposes as they p
project formate for monocot and dicot plants in feild per month
WHAT ARE TYPES OF EGG
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
What is genetic engineering? The Genetic engineering is the use of genetic knowledge to artificially manipulate genes: It is one of the fields of biotechnology.
Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4 Various protein-codi
Q. What is the anoxia? Anoxia is a situation in which there is no available oxygen in the cell without oxygen the respiratory chain stops there is no ATP production the cell do
Define the Food microbiology, mycology and toxicology? Use of yeasts, moulds and bacteria in production of foods and food ingredients; microbes in fermentation, processing and
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd