Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Summer Stratification - Thermal stratification
Thermal stratification is fairly pronounced during the summer seasons in most lakes of the temperate (cold) regions but is rare in lakes of tropical (hot) and subtropical regions where it occurs only in very deep lakes. This is so, because the rate of mixing of layers is very fast in case of tropical lakes whereas, the temperate lakes retain well defined layers showing different temperature. These layers do not mix rapidly. Therefore the temperate lakes exhibit clear stratification with respect to temperature. Let us understand how thermal stratification develops in water bodies and why it is maximum during the summer seasons.
In lakes the top one metre of the water surface directly absorbs around 90 per cent of the total solar radiation falling on it and is considerably more heated in the process. Consequently, the lower sub-surface layers receive progressively less radiation and remain relatively cool. Thus, the lake becomes thermally stratified, with its water forming layers due to temperature differences or thermal gradients. Thermal stratification is maximum during the summer season, primarily due to two reasons. Firstly, due to the fact that solar intensity increases during this period and it heats the surface layer greatly while the lower layers remain comparatively cool. Secondly, the thermally stratified layers offer resistance to mixing by wind. The fairly pronounced stratification of lakes developed in summer is called summer stratification or stagnation.
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Why do you think that bioinformatics is important? Ans) Today, we can use computers to access much more biological data than still before. You can learn a lot by analysi
explain in detail various types of epithelial tissue
Cages for keeping animals in the science room It is frequently desirable in elementary and general science to stay animals caged in the science room for short periods of observ
Q. What are the Yeasts? Like mold, the term "yeast" is commonly used but hard to define. As used here it refers to those fungi which are generally not filamentous but unicellul
Who did EPA consult with outside of the Agency in making this rule? EPA consulted with many agencies, organizations, and individuals in the process of finalizing the plant- inc
Which are the beings that form the kingdom Animalia? What are the two big groups into which this kingdom is divided? The kingdom Animalia is the animal kingdom. Commonly the ki
Q. Can you explain Ventricular Septal Defect? VSD can be found in various part of ventricular septum hence all possible views except suprasternal views are used to detect an
Explain the Primary Treatment for Managing Food Allergies? The primary treatment for managing food allergies is eliminating the offending food or foods. In fact, non-pharmacolo
what are intergenic interactions ? please explain with example of cross breeding. and how we calculate the phenotype and genotype. explain epistasis, duplicate genes, supplementary
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd