Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Plant sources Although there is a multitude of colours in the plant kingdom, their extraction and use in food systems is not an easy task. Unless the colourants have some outst
What is the basic morphology of a protozoan cell? Protozoans are eukaryotic cells so they have organelles and structures common to this part of cell: endoplasmic reticula, Gol
Evolution of Metazoa The sponges, coming under phylum Porifera are the closest to Protista, and can perhaps be regarded even as a colony of protists rather than being multicel
What is Iris Coloboma Coloboma is a congenital abnormality due to non-fusion of the embryonic choroidal fissure. It can affect any part of the eye and may involve the optic ner
The allele that causes albinism (p) is recessive to the allele for normal pigmentation (P). A normal woman whose father is an albino marries an albino man whose parents are both no
Liver function test should be done for all diabetic patients. This will help the doctor in the choice of drugs for the treatment of diabetes since liver abnormalities influence the
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Which of the following contributes to the degeneracy of the genetic code? A. The presence of 64 codons but only 20 amino acids. B. The ability of a single tRNA to bind to ma
How is the transport of substances done across the bryophyte tissues? How is this feature related to the general size of these plants? In bryophytes there are no water-conduct
Ans) The plant cell wall has structural and protective functions. It plays significant role in the constraint of the cell size, preventing the cell to break when it absorbs much wa
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd