Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Subtropical rain forests - Ecosystem
In regions of fairly high rainfall but less temperature differences between winter and summer and broad-leaved evergreen subtropical biome is found. The vegetation includes mahogany, gumbo limbo, bays, palms, oaks, magnolias, tamarind, all laden with epiphytes (if pineapple and orchid families), ferns, vines and strangler fig (Ficus, aureus). Animal life of subtropical forest is very similar to that of tropical rainforests.
Explain the Transmission Electron Microscope Here, thin and dehydrated specimen is used. Electrons pass through the specimen and form image on to photographic film. These are u
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Q. Which Foods are used by Microorganisms for Energy? The carbohydrates, especially the sugars, are most commonly used as an energy source, but other carbon compounds can also
In interspecific sterility, the failure in mating occurs because of inability of the sperm to reach the egg in animals and the pollen to reach ovules in plants. In plailts interspe
Over the last three decades medical imaging has developed to be an important tool for medical condition diagnosis, treatment planning and surgery. The insight provided by informati
What is the alternative means for transport of substances in animals without a circulatory system? Why is blood significant for larger animals? In animals that do not present t
#questionmmmm
Agro Industrial-Incriminating factors in feeds There are many anti-nutritional factors present in feeds and fodders which affect the utilization of nutrients. Some of these are
Although there are differences in interpretation of the evidence, it is generally accepted that human biological evolution has not been a linear progression from one species to the
What are the final digestion products of (a) protein, (b) fat, (c) starch? a) Proteins are digested to amino acids, b) fats are digested to fatty acids and glycerol,
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd