Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The Intine Layer As soon as the tetrads release the microspores, the inner layer of the pollen wall (intine) is formed. Proteinaceous lamellae are embedded in the matrix of th
Vasa efferentia are the ductules leading from: 1. Testicular lobules to rete testis 2. Rete testis to vas deferens 3. Vas deferens to epididymis 4. Epididymis to urethra
Q. Fiehes test and Aniline chloride test? Determine the adulteration in the given honey sample by Fiehe's test and Aniline chloride test This activity will help you to: •
Protozoans - Body Form The protozoan body is usually bound only by the cell membrane called plasmalemma. In some protozoans such as in ciliates the rigidity and the flexibili
Q. What are the structures that form the external ear? What is its function? The internal ear comprises the auricle or pinna and the auditory canal its function is to conduct t
Q. What are zoonoses? What are few examples of zoonoses transmitted by birds? Zoonoses are human diseases transmitted by animals. Psittacosis, a bacterial disease, cryptococcos
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Explain Metameric in detail. A body plan which consists of a series of identical units, metameres, repeated down longitudinal axis of the animal. Every metamere contains identi
Relation between Tissue and the implant material The biologic interaction between the tissue and the implant material at an interface may result in a variety of phenomena such
What are abiotic factors? Abiotic factors are the nonliving elements that constitute a given environment, as light, temperature, minerals, gases, water, atmospheric pressure, e
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd