Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Q. What is prophylaxis? The Prophylaxis is measures taken to prevent diseases. For instance, the use of condoms in sexual relations is a prophylaxis against contamination by ag
Define the major source of vitamin A? The major source of vitamin A, as you may be aware, is the carotenoid pigments which are synthesized by plants. Several carotenoid possess
explain anatomy of bacteria
Adaptations to high wind velocity The mechanical force of the wind and the grinding action of sand, dust, snow and other materials driven by it cause the plants to adapt themse
R a d i o g r a p h y: Radiograph or X-ray remains the most well-known and primary diagnostic tool of all the imaging modalities. It works b
State in brief about the Macronutrients Each element is specific in its function in plant metabolism, however, the exact functions for a number of them are still not known. T
Latitudinal Variations The latitudinal variation of temperature over the earth is the result of two main variables incoming solar radiation and the distribution of lan
Q. What is the glycolysis? And what are the products of this process? Glycolysis, the first stage of the aerobic cell respiration is a process in which glucose is degraded brok
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd