Strategies for help of diabetic patients, Biology

Assignment Help:

It is important that when patients change behaviour they expectt to see results quickly; therefore, the new behaviour must have advantages. So someone who wants to control blood sugar level and reduce weight will modify diet and eating schedule which is easy to follow and brings about control in blood sugar level and weight loss quickly. Encourage patients to make health choices that are easy choices.

In order to bring change in knowledge, skills and attitude, good communication is very important. Ensure support from the family, friends and community. Without support, change is difficult. Health services should be available to the patient near his home or place of work.

As long as life is smooth no one thinks of change. But if any health problem occurs and a person is sick then one thinks for a change or wants to adopt more healthy behaviour. In such a situation, you should ask yourself: "What do these people need in order to change?" Do they need to know more about the problem or do they need to change life style? Where do they need help and guidance? Understand and respect beliefs and norms of the family and community.


Related Discussions:- Strategies for help of diabetic patients

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Functional properties of cardiac muscle, Normal 0 false false...

Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4

Horse diseases-epidemiology, Epidemiology Infection is transmitted   b...

Epidemiology Infection is transmitted   by direct contact between infected domestic and wild animals and susceptible livestock; by arthropod vector (Phlebotomus, Aedes and Cul

Explain the pair of chromosomes and sex chromosomes, Explain the pair of c...

Explain the pair of chromosomes and Sex Chromosomes? Morgan also noticed that one pair of chromosomes is different in male and female flies, one of the male chromosomes being

Illustrate the removal of carbon dioxide from the body, Which of the follow...

Which of the following processes in capillaries in the lung assist in the removal of carbon dioxide from the body? A. Net flux of carbon dioxide from red blood cells into plasm

Diffusion of gases, Diffusion of Gases Gases diffuse from areas of hi...

Diffusion of Gases Gases diffuse from areas of higher partial pressure to areas of lower partial pressure. The diffusion along the partial pressure gradient ceases only when

Growth charts, Growth Charts Management alone without any standard of ...

Growth Charts Management alone without any standard of comparison do not serve useful purpose. A number of standards have been developed to compare the measurement of any

Explain what is cyanosis and polycythemia, Explain what is Cyanosis and pol...

Explain what is Cyanosis and polycythemia? Cyanosis and Polycythemia: Central cyanosis involving the mucous membranes and trunk along with the lips and extremities in absence

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd