Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
It is important that when patients change behaviour they expectt to see results quickly; therefore, the new behaviour must have advantages. So someone who wants to control blood sugar level and reduce weight will modify diet and eating schedule which is easy to follow and brings about control in blood sugar level and weight loss quickly. Encourage patients to make health choices that are easy choices. In order to bring change in knowledge, skills and attitude, good communication is very important. Ensure support from the family, friends and community. Without support, change is difficult. Health services should be available to the patient near his home or place of work. As long as life is smooth no one thinks of change. But if any health problem occurs and a person is sick then one thinks for a change or wants to adopt more healthy behaviour. In such a situation, you should ask yourself: "What do these people need in order to change?" Do they need to know more about the problem or do they need to change life style? Where do they need help and guidance? Understand and respect beliefs and norms of the family and community.
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4
Epidemiology Infection is transmitted by direct contact between infected domestic and wild animals and susceptible livestock; by arthropod vector (Phlebotomus, Aedes and Cul
Explain the pair of chromosomes and Sex Chromosomes? Morgan also noticed that one pair of chromosomes is different in male and female flies, one of the male chromosomes being
Which of the following processes in capillaries in the lung assist in the removal of carbon dioxide from the body? A. Net flux of carbon dioxide from red blood cells into plasm
what is persons subunit
Diffusion of Gases Gases diffuse from areas of higher partial pressure to areas of lower partial pressure. The diffusion along the partial pressure gradient ceases only when
separation of nucleic acid
Growth Charts Management alone without any standard of comparison do not serve useful purpose. A number of standards have been developed to compare the measurement of any
Explain what is Cyanosis and polycythemia? Cyanosis and Polycythemia: Central cyanosis involving the mucous membranes and trunk along with the lips and extremities in absence
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd