Steps of initiation , Biology

Assignment Help:

The entire mechanism of protein synthesis in eukaryotes is generally the same as in prokaryotes, with three phases explained as termination, elongation and initiation. Furthermore, there are some significant differences, mainly in during initiation.

?   Whereas a prokaryotic  ribosome  has a sedimentation  coefficient of 70S and subunits of 50S and 30S, a eukaryotic ribosome has a sedimentation  coefficient  of 80S  with  subunits  of 60S and  40S.  The composition of eukaryotic ribosomal subunits is also more difficult than prokaryotic subunits but the function of every subunit is essentially the similar as in prokaryotes.

?   In eukaryotes,  each mRNA is monocistronic  which is, discounting  any subsequent   post-translational  cleavage   reactions   which   should   happen  the  mRNA encodes  a one  protein.  In prokaryotes, various mRNAs are polycistronic which is they encode many proteins.  every coding sequence in a prokaryotic mRNA has its own termination and initiation codons.

? Starting of the protein synthesis in eukaryotes needs at least nine distinct eukaryotic initiation factors (eIFs) compared with the three initiation factors (IFs) in prokaryotes.

?   In the eukaryotes, initiating amino acid is methionine isnot N-formylmethionine as in prokaryotes.

 


Related Discussions:- Steps of initiation

What is the morphological feature of molluscs, Q What is the morphological ...

Q What is the morphological feature of molluscs after which the phylum is named? The word "mollusc" imply "soft thing". Molluscs have soft bodies and this feature describes the

What do numeric pyramids represent?, What do numeric pyramids represent? ...

What do numeric pyramids represent? The Numeric pyramids represent the number of individuals in each trophic level of a food chain.

Parasympathetic discharge to the heart leads to, An enhance in parasympathe...

An enhance in parasympathetic discharge to the heart leads to A. An enhance in the conductance of F-channels in SA node cells. B. An enhance in the conductance of potassium

Phylum protozoa, diversification and economic importance

diversification and economic importance

Diagnosis and treatment of myocarditis, Diagnosis X-ray chest show...

Diagnosis X-ray chest shows cardiomegaly.  ECG shows conduction defect, low voltage QRS, atrial and ventricular disrhythrnias.  Echocardiogram - decreased LV cont

How do fishes do gas exchange, Q. How do fishes do gas exchange? Fishes...

Q. How do fishes do gas exchange? Fishes "breath" through gills, branchiae or Gills, are highly vascularized organs specialized in gas exchange under water and present in aquat

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Cause the inhibition of apoptosis, We now understand that mutations that ca...

We now understand that mutations that cause the inhibition of apoptosis are found in tumors. Because proliferation itself is not induced by the inhibition of apoptosis, explain how

Explain the female reproductive system, Explain the Female Reproductive Sys...

Explain the Female Reproductive System? The female reproductive system consists of the primary sex organs, the ovaries, and the accessory organs necessary to effect fertilizati

Leucosolenia, special character of leucosolenia

special character of leucosolenia

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd