Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The entire mechanism of protein synthesis in eukaryotes is generally the same as in prokaryotes, with three phases explained as termination, elongation and initiation. Furthermore, there are some significant differences, mainly in during initiation.
? Whereas a prokaryotic ribosome has a sedimentation coefficient of 70S and subunits of 50S and 30S, a eukaryotic ribosome has a sedimentation coefficient of 80S with subunits of 60S and 40S. The composition of eukaryotic ribosomal subunits is also more difficult than prokaryotic subunits but the function of every subunit is essentially the similar as in prokaryotes.
? In eukaryotes, each mRNA is monocistronic which is, discounting any subsequent post-translational cleavage reactions which should happen the mRNA encodes a one protein. In prokaryotes, various mRNAs are polycistronic which is they encode many proteins. every coding sequence in a prokaryotic mRNA has its own termination and initiation codons.
? Starting of the protein synthesis in eukaryotes needs at least nine distinct eukaryotic initiation factors (eIFs) compared with the three initiation factors (IFs) in prokaryotes.
? In the eukaryotes, initiating amino acid is methionine isnot N-formylmethionine as in prokaryotes.
Q What is the morphological feature of molluscs after which the phylum is named? The word "mollusc" imply "soft thing". Molluscs have soft bodies and this feature describes the
What do numeric pyramids represent? The Numeric pyramids represent the number of individuals in each trophic level of a food chain.
An enhance in parasympathetic discharge to the heart leads to A. An enhance in the conductance of F-channels in SA node cells. B. An enhance in the conductance of potassium
diversification and economic importance
Diagnosis X-ray chest shows cardiomegaly. ECG shows conduction defect, low voltage QRS, atrial and ventricular disrhythrnias. Echocardiogram - decreased LV cont
Q. How do fishes do gas exchange? Fishes "breath" through gills, branchiae or Gills, are highly vascularized organs specialized in gas exchange under water and present in aquat
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
We now understand that mutations that cause the inhibition of apoptosis are found in tumors. Because proliferation itself is not induced by the inhibition of apoptosis, explain how
Explain the Female Reproductive System? The female reproductive system consists of the primary sex organs, the ovaries, and the accessory organs necessary to effect fertilizati
special character of leucosolenia
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd