Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Myasthenia Gravis
Myasthenia gravis (severe muscle weakness) is characterised by muscular fatigue in the wake of very little exercise. It may be apparent after a short period of exercise or work, toward the end of a long conversation, or sometimes even after a few repetitions of a movement. Rest brings a feeling of recovery. The rapid onset of weakness after exercise distinguishes myasthenia gravis from other disorders such as depression or general fatigue. There are no visible signs of muscle pathology
Food Applications of Agar The bakery industry has been the largest user of agar because of its heat- resistant gel properties. Confectionary products, such as agar jelly candi
Some species of plant are strongly adapted to pollination by certain insects. Characteristics which are regarded as adaptations to pollination by bees are: ( a) white o
which part of human body purify the blood
(i) Genetic Bio- Diversity: All forms of life on earth contain genes. Genes are carrier of hereditary characteristic from one generation to another. " genetic diver
why do i do it for class/
Define the Functional Properties of Proteins? a) Hydration properties (dependent on protein-water interactions), which include properties like swelling, adhesion, dispersibilit
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
What are the advancement of cnidaria over protozoa
What is the excreatory organ of crab
Q. Non-Modifiable Risk Factors for coronaru heart diseases? Non-Modifiable Risk Factors 1. Age 2. Sex 3. Heredity 4. Endomorphic Body Build Family history: Pe
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +1-415-670-9521
Phone: +1-415-670-9521
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd