State the term - myasthenia gravis, Biology

Assignment Help:

Myasthenia Gravis

Myasthenia gravis (severe muscle weakness) is characterised by muscular fatigue in the wake of very little exercise. It may be apparent after a short period of exercise or work, toward the end of a long conversation, or sometimes even after a few repetitions of a movement. Rest brings a feeling of recovery. The rapid onset of weakness after exercise distinguishes myasthenia gravis from other disorders such as depression or general fatigue. There are no visible signs of muscle pathology

 


Related Discussions:- State the term - myasthenia gravis

Explain food applications of agar, Food Applications of Agar The bakery...

Food Applications of Agar The bakery industry has been the largest user  of agar because of its heat- resistant gel properties. Confectionary products, such as agar jelly candi

Some species of plant are strongly adapted to pollination, Some species of ...

Some species of plant are strongly adapted to pollination by certain insects.   Characteristics which are regarded as adaptations to pollination by bees are: ( a) white o

Heart, which part of human body purify the blood

which part of human body purify the blood

Types of biodiversity, (i)     Genetic  Bio- Diversity: All forms of l...

(i)     Genetic  Bio- Diversity: All forms of life on earth contain genes. Genes are carrier of hereditary characteristic from one generation to another. " genetic diver

Phylogeny, why do i do it for class/

why do i do it for class/

Define the functional properties of proteins, Define the Functional Propert...

Define the Functional Properties of Proteins? a) Hydration properties (dependent on protein-water interactions), which include properties like swelling, adhesion, dispersibilit

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Cnidaria and protozoan, What are the advancement of cnidaria over protozoa

What are the advancement of cnidaria over protozoa

Non-modifiable risk factors for coronaru heart diseases, Q. Non-Modifiable ...

Q. Non-Modifiable Risk Factors for coronaru heart diseases? Non-Modifiable Risk Factors 1. Age 2. Sex 3. Heredity 4. Endomorphic Body Build Family history: Pe

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd