State the internal chromosomal segments, Biology

Assignment Help:

Which of the following best explains the reason why DNA ligase is needed to complete the replication of internal chromosomal segments?

A. DNA ligase is able to delete the last nucleotide of the oligonucleotide that is left by RNaseH.

B. DNA ligase is able to incorporate nucleotides into the gap that is left by RNaseH and the exonuclease.

C. DNA ligase is able to obtain the final phosphodiester bond thereby fixing single stranded nicks that are left by DNA polymerase.

D. DNA ligase is capable to relieve the tangles that happen ahead of the replication fork.

 


Related Discussions:- State the internal chromosomal segments

State about bone physiology, State about Bone physiology Bone physiolog...

State about Bone physiology Bone physiology that is most relevant to the study of mechanically mediated bone adaptation and its relevance in implant dentistry. These aspects in

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

How much ampicillin can dissolve in 400 ml, How much ampicillin (sodium sal...

How much ampicillin (sodium sal, mw=371.40) would you dissolve in 400 mL of water to make 80 mg/ml solution of ampicillin?

Working of eye, WORKIN G OF EYE - Human eye is sensitive to light wave...

WORKIN G OF EYE - Human eye is sensitive to light wavelenght ranging from 380 - 760 nm. Bees, ants, spiders and gold fish can see uttraviolet light which is invisible to hu

Explain about the deranged lipid profile, Explain about the Deranged lipid ...

Explain about the Deranged lipid profile? Lipids, as you are already aware, are important dietary constituents that include fats, steroids, phospholipids and glycolipids. A num

Determine the statement- the evolution of color vision, Based on your readi...

Based on your reading of the article entitled "The Evolution of Color Vision", which of the following is a false statement? A. Trichomatic vision is found in all male and femal

Illustrate dark reactions, Q. Why is the nickname "dark reactions" not comp...

Q. Why is the nickname "dark reactions" not completely correct for the chemical stage of photosynthesis? "Dark reactions" is not a correct name for the chemical phase of photos

What are passive and active immunization, What are passive and active immun...

What are passive and active immunization? According to the duration of the protection how do these types of immunization differ? Active immunization is that in which an antigen

Difference between self pollination and cross pollination, What is the diff...

What is the difference between self pollination and cross pollination? Which of these two modes of pollination contributes more to the plant diversity? Self pollination happens

Zoology, Is viruses classified as living organism? If yes/no why

Is viruses classified as living organism? If yes/no why

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd