State the continuous sutures suturing technique, Biology

Assignment Help:

State the Continuous sutures Suturing technique

It can be used to attach 2 surgical flap edges or to secure multiple interproximal papillae of one flap independently of the other flap.

 

 

 


Related Discussions:- State the continuous sutures suturing technique

The right side of the container, A solute passes from higher concentration ...

A solute passes from higher concentration on the left of a container to the right side of container thru a membrane. What would happen if a second solute of lower concentration was

Fowl spirochaetosis, Fowl spirochaetosis The causal agent Borrelia anse...

Fowl spirochaetosis The causal agent Borrelia anserina is a spiral-shaped organism about 8-30 um in length but commonly 14-15 um long and 0-3 um wide. The organisms are activel

Define about the iodine toxicity, Define about the Iodine Toxicity? A w...

Define about the Iodine Toxicity? A wide range of iodine intakes is tolerated by most individuals, owing to the ability of the thyroid to regulate total body iodine. This toler

Matter - living and non-living, Matter - Living and Non-Living Our uni...

Matter - Living and Non-Living Our universe is made up of two basic components:, matter and. energy. Matter, as you know, has mass; it occupies space. You can touch matter. It

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Transcription and processing of trna in prokaryotes , The rRNA transcriptio...

The rRNA transcription units in E. coli hold some tRNA genes which are processed and transcribed at the time of rRNA transcription. The other tRNA genes  happen  in  clusters  of

Explain the histologic techniques, Explain the histologic techniques A...

Explain the histologic techniques A clinician has to base the diagnosis only on the clinical and radiographic findings as microbiologic and histologic techniques are restricte

What are the dietary guidelines for gastritis, Q. What are the dietary guid...

Q. What are the dietary guidelines for gastritis? Energy: Give adequate calories through frequent feedings or else proteins would be utilized for energy of repair work. P

How does the amoeboid movement occur, Q How does the amoeboid movement occu...

Q How does the amoeboid movement occur and what are examples of beings and cells that use such movements for locomotion? Amoeboid movements are created by cytoplasmic movements

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd