State the basic properties of cell, Biology

Assignment Help:

State the basic properties of Cell

The differences of cell types notwithstanding, the similarities among them are more profound. Actually, all cells possess the same basic properties, some of which are outlined below:

  • All cells store information in genes.
  • Ribosomes synthesise proteins in all cells.
  • Proteins control the structure and function in all cells.
  • ATP is the molecule used by all cells to transfer energy.
  • Plasma membrane is a common feature in all cells.

 


Related Discussions:- State the basic properties of cell

Define the stability of your favourite protein kinase, You measure the stab...

You measure the stability of your favourite protein kinase and find that half of the protein is degraded every 10 minutes. How might you test whether the protein is degraded throug

Gastrulation, Gastrulation The end of cleavage of the unicellular zyg...

Gastrulation The end of cleavage of the unicellular zygote results in the creation of multicellular blastula, which may be a solid structure with no a cavity (stereoblastula)

Why does the recombination frequency of genes vary, Why does the recombinat...

Why does the recombination frequency of genes vary with the distance between them in the chromosome? The farther the distance among the loci of two genes in a chromosome the hi

Eye muscles, MUSCLES - In eye orbit, eye ball is fixed by 6 skeletal...

MUSCLES - In eye orbit, eye ball is fixed by 6 skeletal muscles attached to 3rd, 4th & 6th cranial nerves (motor). 4 - straight or recti muscles are present. 2 - oblique

Transport of substances done across the bryophyte tissues, Q. How is the tr...

Q. How is the transport of substances done across the bryophyte tissues? How is this feature related to the general size of these plants? In bryophytes there are no nutrient-co

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Five kingdom classification, discuss the merits nd demerits of five kingdom...

discuss the merits nd demerits of five kingdom classification.

Microbiology, Applications of microbiology in different fields

Applications of microbiology in different fields

What is meant by concentration gradient, What is meant by concentration gra...

What is meant by concentration gradient? Is it correct to refer to "concentration gradient of water"? Concentration gradient is the difference of concentration of a substance

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd