State about intra oral periapical radiographs, Biology

Assignment Help:

Intra Oral Periapical Radiographs

These can either be taken conventionally or by the help of RVG (RADIO VISUO GRAPHY).  RVG offers certain benefits over conventional X-Rays such as images can be stored, manipulated, and corrected for under- and overexposures.

But one of the most important is reduction in dose of exposure to  radiation. IOPA radiographs cannot accurately reflect the bone morphology buccally andlingually but they provide useful information on interproximal bone levels.

They also provide information on the root length, root proximity, and presence of periapical lesions and estimates of remaining alveolar bone. It helps in diagnosing minute pathologic changes in the periodontium which could interfere with implant placement.

 


Related Discussions:- State about intra oral periapical radiographs

How is light from the sun transformed into chemical energy, How is light fr...

How is light from the sun transformed into chemical energy to be used by the living beings on earth? Light from the sun is transmitted into chemical energy contained in organic

Define viscosity - function of proteins, Explain Viscosity of proteins ...

Explain Viscosity of proteins Viscosity reflects resistance to flow. The  main  single factor influencing the viscosity  behavior  of protein  fluids  is   the  apparent  diame

Explain irradiation, Explain Irradiation The physical process of expos...

Explain Irradiation The physical process of exposing an object, system, or a material to a high radiant energy for the sterilization or preservation.

Define phenolic acids and derivatives, Define Phenolic Acids and Derivative...

Define Phenolic Acids and Derivatives? Two families of phenolic acids are widely distributed in plants: a range of benzoic acid derivatives and those derived from cinnamic acid

How is the circulatory system of birds characterized, Q How is the circulat...

Q How is the circulatory system of birds characterized? Like every vertebrate, Birds, have a closed circulatory system. The heart is similar to the mammalian heart, having four

Define preterm and low birth weight, Define Preterm and Low Birth Weight? ...

Define Preterm and Low Birth Weight? The foetal and neonatal health is mainly dependent on the birth weight and it has been well recognized that perinatal (from birth upto one

What is coevolution, What is Coevolution ? There is considerable eviden...

What is Coevolution ? There is considerable evidence that supports an interesting theory that two individual species can affect each others evolution in reciprocal fashion. In

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Explain the procedure of taking blood pressure, Explain the Procedure of Ta...

Explain the Procedure of Taking Blood Pressure - Explain the procedure to the patient. In case patient is coming for first time to check the blood pressure explain to the patie

What are sarcomeres, What are sarcomeres? Sarcomeres are the contractil...

What are sarcomeres? Sarcomeres are the contractile units of the muscle tissue formed of alternating actin blocks (thin filaments) and myosin blocks (thick filaments). Various

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd