Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Intra Oral Periapical Radiographs
These can either be taken conventionally or by the help of RVG (RADIO VISUO GRAPHY). RVG offers certain benefits over conventional X-Rays such as images can be stored, manipulated, and corrected for under- and overexposures.
But one of the most important is reduction in dose of exposure to radiation. IOPA radiographs cannot accurately reflect the bone morphology buccally andlingually but they provide useful information on interproximal bone levels.
They also provide information on the root length, root proximity, and presence of periapical lesions and estimates of remaining alveolar bone. It helps in diagnosing minute pathologic changes in the periodontium which could interfere with implant placement.
How is light from the sun transformed into chemical energy to be used by the living beings on earth? Light from the sun is transmitted into chemical energy contained in organic
Explain Viscosity of proteins Viscosity reflects resistance to flow. The main single factor influencing the viscosity behavior of protein fluids is the apparent diame
Explain Irradiation The physical process of exposing an object, system, or a material to a high radiant energy for the sterilization or preservation.
Define Phenolic Acids and Derivatives? Two families of phenolic acids are widely distributed in plants: a range of benzoic acid derivatives and those derived from cinnamic acid
Q How is the circulatory system of birds characterized? Like every vertebrate, Birds, have a closed circulatory system. The heart is similar to the mammalian heart, having four
Define Preterm and Low Birth Weight? The foetal and neonatal health is mainly dependent on the birth weight and it has been well recognized that perinatal (from birth upto one
What is Coevolution ? There is considerable evidence that supports an interesting theory that two individual species can affect each others evolution in reciprocal fashion. In
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Explain the Procedure of Taking Blood Pressure - Explain the procedure to the patient. In case patient is coming for first time to check the blood pressure explain to the patie
What are sarcomeres? Sarcomeres are the contractile units of the muscle tissue formed of alternating actin blocks (thin filaments) and myosin blocks (thick filaments). Various
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +1-415-670-9521
Phone: +1-415-670-9521
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd