Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
What evidence did Charles Elton collect that suggested that fluctuations in hare and lynx populations were related?
What other evidence shows that these fluctuations may not have been related?
Elton found that both hare and lynx populations underwent regular cycles, with peaks in the lynx population usually following those in the hare population by a year or two. Other evidence showed that hare populations underwent the similar cycles on islands without lynxes.
three types of trophic pyramids
Q. What is the function of the umbilical cord? The umbilical cord is a set of blood vessels that connects the fetus with the placenta and in the fetus one extremity of the cord
Social Status and Support Network Income and Social Status: Higher income and social status lead to better health.Employed persons, having more control over their workin
Indications for Surgery : The normal mitral valve area is 4-5 cm 2 . Usually symptoms appear when the valve area has become less than 2.5 cm2. Symptoms are present at rest when t
Brain Brain is a part of central nervous system which lies in the skull. Source: Sears and Windwood, Anatomy and Physiology for Nurses The different parts of the bra
Q. What are the major endocrine glands of the human body? The major endocrine glands of the human body are the hypophysis (or pituitary), the pineal gland (or pineal body), the
In a properly functioning negative feedback system, the A. value of the controlled variable will always be very close to the threshold value when the system is in steady state.
A kinase is in general an enzyme which catalyzes the transfer of the phosphate group from ATP to something else. In the molecular biology, it has acquired the more specific verbal
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Q. What is competition? Which type of ecological interaction is competition? The Competition is the ecological interaction in which the individuals explore the similar ecologic
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd