Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Stabilisation - Climax
The whole process of succession results in stabilisation of the vegetation which is now in complete harmony with the environmental complex of that place. And it is likely to persist as long as the climatic and physiographic conditions remain unchanged. The soil is fully occupied by plants and the community is closed. Only those species, which are capable of completing their life cycles, despite the intense competition, establish themselves, the homeostasis is thus attained. This final community is not replaced, and is known as climax community and the stage as climax stage.
The kind of succession that takes place from simple, few forms to complex, several kinds of forms are known as progressive succession. In some cases, reverse situation is seen, that is, the process of succession, instead of being progressive becomes retrogressive. This may be due to the destructive effects of organisms. For example, a forest changing into a grassland community is an example of retrogressive succession.
Q. Causes of Diabetic Ketoacidosis? The causes of Diabetic Ketoacidosis (DKA) are the following: - Missing of insulin injection - Infection - Trauma (injury) - Myoc
Explain Glutathione peroxidase Glutathione peroxidase is a natural antioxidant present in many tissues. Together, with vitamin E it is part of the body's defense against lipi
Q. Show Non-Modifiable Risk Factors for cardiovascular disease? Age: Earlier men less than 55 years were more prone but now heart disease has caught up with a younger age-gro
Determine the prevention of Cholera Prevention: Following recommendations are there to prevent cholera outbreak: Drink only water that you have boiled or treated with
Drosophila has 4 bivalents (homologous chromosomes) formed at Meiosis I. How many chromosomes and chromatin strands are present in each of the following stages- Anaphase of mito
Determine Some indicators of Malnutrition? A few of the indicators are enumerated below: 1. Indicators related to Government policies a. Nutrition policy b. Nutrition
Question 1 Discuss how would you perform antiglobulin test? Add a note on it clinical importance. What are the precautions to be taken while performing the test? Question 2 E
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
VARI A TION S - Defined as "dissimilarities of features among members of the same species". Offsprings of same parent are different and also differ from their parent.
Q. What is the importance of pre procedural rinse? Patients' use of an anti-microbial mouthwash of 0.12% chlorhexidine gluconate solution for 30 seconds prior to intra-oral pro
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd