Stabilisation - climax, Biology

Assignment Help:

Stabilisation - Climax

The whole process of succession results in stabilisation of the vegetation which is now in complete harmony with the environmental complex of that place. And it is likely to persist as long as the climatic and physiographic conditions remain unchanged. The soil is fully occupied by plants and the community is closed. Only those species, which are capable of completing their life cycles, despite the intense competition, establish themselves, the homeostasis is thus attained. This final community is not replaced, and is known as climax community and the stage as climax stage.

The kind of succession that takes place from simple, few forms to complex, several kinds of forms are known as progressive succession. In some cases, reverse situation is seen, that is, the process of succession, instead of being progressive becomes retrogressive. This may be due to the destructive effects of organisms. For example, a forest changing into a grassland community is an example of retrogressive succession.


Related Discussions:- Stabilisation - climax

Causes of diabetic ketoacidosis, Q. Causes of Diabetic Ketoacidosis? Th...

Q. Causes of Diabetic Ketoacidosis? The causes of Diabetic Ketoacidosis (DKA) are the following: - Missing of insulin injection - Infection - Trauma (injury) - Myoc

Explain glutathione peroxidase, Explain Glutathione peroxidase Glutathi...

Explain Glutathione peroxidase Glutathione peroxidase is a natural antioxidant present in many tissues. Together, with vitamin E it  is part of the body's  defense against lipi

Show non-modifiable risk factors for cardiovascular disease, Q. Show Non-Mo...

Q. Show Non-Modifiable Risk Factors for cardiovascular disease? Age: Earlier men less than 55 years were more prone but now heart disease has caught up with a younger age-gro

Determine the prevention of cholera, Determine the prevention of Cholera ...

Determine the prevention of Cholera Prevention:  Following recommendations are  there to prevent cholera  outbreak: Drink only water that you have boiled or treated with

Chromosomes and chromatin strands are present in stage, Drosophila has 4 bi...

Drosophila has 4 bivalents (homologous chromosomes) formed at Meiosis I. How many chromosomes and chromatin strands are present in each of the following stages- Anaphase of mito

Determine some indicators of malnutrition, Determine Some indicators of Mal...

Determine Some indicators of Malnutrition? A few of the indicators are enumerated below: 1. Indicators related to Government policies a. Nutrition policy b. Nutrition

Discuss how would you perform antiglobulin test, Question 1 Discuss how wo...

Question 1 Discuss how would you perform antiglobulin test? Add a note on it clinical importance. What are the precautions to be taken while performing the test? Question 2 E

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Variations, VARI A TION S - Defined as "dissimilarities of featur...

VARI A TION S - Defined as "dissimilarities of features among members of the same species". Offsprings of same parent are different and also differ from their parent.

What is the importance of pre procedural rinse, Q. What is the importance o...

Q. What is the importance of pre procedural rinse? Patients' use of an anti-microbial mouthwash of 0.12% chlorhexidine gluconate solution for 30 seconds prior to intra-oral pro

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd