St-segment depression after hyperventilation, Biology

Assignment Help:

Q. ST-segment depression after  hyperventilation?

Patients with abnormal autonomic drive have demonstrated ST-segment depression after hyperventilation as well as after exercise. Patients who display ST-segment depression at rest or an increased ST-segment depression after hyperventilation, in whom the depression tends to return to normal with exercise usually do not have epicardial CAD. Changes associated with hyperventilation are associated with normal coronary arteries. Propranolol and other beta-blockers have been shown to back the ST changes associated with hyperventilation, suggesting an autonomic etiology. The common findings that body position may produce similar changes tends to support this concept. These types of changes are common in patients with mitral prolapse.


Related Discussions:- St-segment depression after hyperventilation

Explain the importance of the auxin, a) How is the milk production regulate...

a) How is the milk production regulated by hormones in human female? Define. b) Explain the importance of the auxin / cytokinin ratio in plant tissue culture.

Relate the oxide layer and biocompatibility of titanium, Relate the oxide l...

Relate the oxide layer and biocompatibility of titanium. The compatibility of a metal with its host environment depends on its resistance to biodegradation and on the degree of

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Patient with diabetes mellitus, Educating a patient with diabetes mellitus....

Educating a patient with diabetes mellitus. At this point you have understood in detail about diabetes mellitus, its management and complications. You can appreciate now why it is

Water relations in terrestrial environment, Water Relations in Terrestrial ...

Water Relations in Terrestrial Environment Insects are the largest group of metazoans which have most successfully invaded the terrestrial environment. In addition, most arach

Very low density lipoproteins, Triglyceride and cholesterol synthesized in ...

Triglyceride and cholesterol synthesized in the liver are secreted in very low density lipoprotein (VLDL) particles which serve to transport the lipids to the periphery. VLDL form

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd