St-segment depression after hyperventilation, Biology

Assignment Help:

Q. ST-segment depression after  hyperventilation?

Patients with abnormal autonomic drive have demonstrated ST-segment depression after hyperventilation as well as after exercise. Patients who display ST-segment depression at rest or an increased ST-segment depression after hyperventilation, in whom the depression tends to return to normal with exercise usually do not have epicardial CAD. Changes associated with hyperventilation are associated with normal coronary arteries. Propranolol and other beta-blockers have been shown to back the ST changes associated with hyperventilation, suggesting an autonomic etiology. The common findings that body position may produce similar changes tends to support this concept. These types of changes are common in patients with mitral prolapse.


Related Discussions:- St-segment depression after hyperventilation

Deficiency diseases-osteodystrophia fibrosa, Osteodystrophia fibrosa Os...

Osteodystrophia fibrosa Osteodystrophia fibrosa is a bone disorder arising due to secondary calcium deficiency in horses, pigs and goats. The disease is characterized by painfu

Determine the structural classification of bone, Structural classification ...

Structural classification of bone Macroscopically, bone tissue can be classified into two types, compact and trabecular bone. Compact bone is dense, corticated and makes up the

What are tannins, What are Tannins? Long known for their inhibitory eff...

What are Tannins? Long known for their inhibitory effects on iron absorption, recent research indicates that tannins do have beneficial effects. Tannins are compounds of high m

What is the predicted cell morphology, What are the predicted cell morpholo...

What are the predicted cell morphology, cell arrangement and gram stain results for each of the follow? 1. Bacillus megaterium 2. Staphylococcus aureus 3. Serratia marcesc

How many alleles of genes that condition x-linked traits do, How many allel...

How many alleles of genes that condition X-linked traits do female and male individuals respectively present? For every correspondent gene to an X- linked trait women present a

Arterial conduits and internal mamnrary artery (ima), Arterial Conduits ...

Arterial Conduits LIMA UMA: anastomosis side-t-side with diaganal8 end-lo-sode with LAD Figure: Arterial conduits Internal Mamnrary Artery (IMA)

What is the formula of the net primary production, What is the formula of t...

What is the formula of the net primary production (NPP)? How does NPP relate to the energy pyramids? Net primary production is the gross main productivity less the organic mate

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Genetics , write about complementary genes

write about complementary genes

What possible combinations of chromosomes will be present, A diploid cell c...

A diploid cell contains three pairs of homologous chromosomes designated C1 and C2, M1 and M2, and S1 and S2; no crossing over occurs. What possible combinations of chromosomes

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd