Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Q. ST-segment depression after hyperventilation?
Patients with abnormal autonomic drive have demonstrated ST-segment depression after hyperventilation as well as after exercise. Patients who display ST-segment depression at rest or an increased ST-segment depression after hyperventilation, in whom the depression tends to return to normal with exercise usually do not have epicardial CAD. Changes associated with hyperventilation are associated with normal coronary arteries. Propranolol and other beta-blockers have been shown to back the ST changes associated with hyperventilation, suggesting an autonomic etiology. The common findings that body position may produce similar changes tends to support this concept. These types of changes are common in patients with mitral prolapse.
Define Classification of proteins on the basis of attributes? Besides classifying proteins on the basis of soluble and insoluble, proteins have been further classified based on
Q. How is excretion done in amphibians? Adult amphibians have kidneys that filter blood. Nitrogen waste is excreted as urea so amphibians are ureotelic beings. The aquatic, lar
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
What is xaxim? Most pteridophytes have subterraneous stems similar to the substrate called as rhizomes. Xaxim is a kind of pteridophyte with an aerial stem in generally perpend
During the last 90 years, man-made materials and devices have been developed to replace parts of living systems in the human body. These special materials function in intimate cont
Pituitary The pituitary is also known as hypophysis. It is composed of two embryologically distinct tissue. The anterior pituitary or adenohypophysis is derived from the roof
(1) The 7,893 bp plasmid shown below was digested with a series of restriction enzymes (P = PstI, B = BamHI, S = SalI, X = XbaI). Answer the questions below. a) Indicate
Q. Why is it dangerous to talk while eating? If a person talks when eating, food may be inhaled into the lungs. Generally after food is swallowed, it passes into pharynx and th
Explain Crossing Over in genetics? Crossing over is when the arms of homologous chromosomes exchange segments (and therefore genes) with each other. Recall that one of the homo
what is meant by morphogenesis in roots and shoot
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd