Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Q. ST-segment depression after hyperventilation?
Patients with abnormal autonomic drive have demonstrated ST-segment depression after hyperventilation as well as after exercise. Patients who display ST-segment depression at rest or an increased ST-segment depression after hyperventilation, in whom the depression tends to return to normal with exercise usually do not have epicardial CAD. Changes associated with hyperventilation are associated with normal coronary arteries. Propranolol and other beta-blockers have been shown to back the ST changes associated with hyperventilation, suggesting an autonomic etiology. The common findings that body position may produce similar changes tends to support this concept. These types of changes are common in patients with mitral prolapse.
Osteodystrophia fibrosa Osteodystrophia fibrosa is a bone disorder arising due to secondary calcium deficiency in horses, pigs and goats. The disease is characterized by painfu
Structural classification of bone Macroscopically, bone tissue can be classified into two types, compact and trabecular bone. Compact bone is dense, corticated and makes up the
What are Tannins? Long known for their inhibitory effects on iron absorption, recent research indicates that tannins do have beneficial effects. Tannins are compounds of high m
What are the predicted cell morphology, cell arrangement and gram stain results for each of the follow? 1. Bacillus megaterium 2. Staphylococcus aureus 3. Serratia marcesc
How many alleles of genes that condition X-linked traits do female and male individuals respectively present? For every correspondent gene to an X- linked trait women present a
Arterial Conduits LIMA UMA: anastomosis side-t-side with diaganal8 end-lo-sode with LAD Figure: Arterial conduits Internal Mamnrary Artery (IMA)
What is the formula of the net primary production (NPP)? How does NPP relate to the energy pyramids? Net primary production is the gross main productivity less the organic mate
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
write about complementary genes
A diploid cell contains three pairs of homologous chromosomes designated C1 and C2, M1 and M2, and S1 and S2; no crossing over occurs. What possible combinations of chromosomes
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd