Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Q. ST-segment depression after hyperventilation?
Patients with abnormal autonomic drive have demonstrated ST-segment depression after hyperventilation as well as after exercise. Patients who display ST-segment depression at rest or an increased ST-segment depression after hyperventilation, in whom the depression tends to return to normal with exercise usually do not have epicardial CAD. Changes associated with hyperventilation are associated with normal coronary arteries. Propranolol and other beta-blockers have been shown to back the ST changes associated with hyperventilation, suggesting an autonomic etiology. The common findings that body position may produce similar changes tends to support this concept. These types of changes are common in patients with mitral prolapse.
nkjn
a) How is the milk production regulated by hormones in human female? Define. b) Explain the importance of the auxin / cytokinin ratio in plant tissue culture.
Relate the oxide layer and biocompatibility of titanium. The compatibility of a metal with its host environment depends on its resistance to biodegradation and on the degree of
define fringing reef
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Educating a patient with diabetes mellitus. At this point you have understood in detail about diabetes mellitus, its management and complications. You can appreciate now why it is
Water Relations in Terrestrial Environment Insects are the largest group of metazoans which have most successfully invaded the terrestrial environment. In addition, most arach
character and classification of pigeon
secretary tapetum
Triglyceride and cholesterol synthesized in the liver are secreted in very low density lipoprotein (VLDL) particles which serve to transport the lipids to the periphery. VLDL form
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd