Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Sporogenous Tissue
The primary sporogenous cells (PSCs) result after the periclinal division of the archesporial cells. The PSCs may undergo mitotic divisions and increase in number before functioning as MMCs or the PSCs may function directly as MMCs. The MMCs undergo meiosis and give rise to haploid microspores. The details of meiosis have been extensively studied. Anthers are ideal systems to study meiosis. This is mainly due to the fact that, they are readily available and accessible for experimentation; and each anther contains a large number of meiocytes, mostly exhibiting synchrony. Most of the information on meiosis has been obtained from investigations on anthers.
Q. Why is rubella during gestation a threat to the fetus? If taking place during gestation rubella is a dangerous disease because the virus crosses the contaminates fetus and t
A genetic trait which is considered to be harmful in the present day might prove to be beneficial in future. For example by removing the trait for sickle cell we may increase the s
Archaeological Records of Human Campsites Archaeological records of human campsites indicate that early humans started out as small bands of hunters who supplemented kills wit
Protein Protein: The requirement of protein is increased in typhoid, as there is a massive tissue loss. Thus, the protein intake should be increased above the normal of lg/
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Q. Basic principles involved ark? The basic principles involved ark: The individual must be treated as such and for that careful initial history - daily living situation, a
Nursing Education Computer-Assisted Instruction (CAI) is a valuable teaching aid for health care students, testing them with frequent quizzes to ensure that the material rea
Describe Valsalva Manocuvre in dynamic auscultation ? This consists of deep inspiration followed by forced inhalation against a closed glottis for 10-20 seconds. It can be perf
what are the classfication and members af phylum protozoa
Discuss about the Halstead Reitan battery The Halstead Reitan battery continues to be widely used as a clinical and research procedure. Numerous investigators use it in their r
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd