Splenic abscess, Biology

Assignment Help:

Splenic infarction is a common complication of left-sided IE (40 per cent of cases). Only 5 per cent of patients with splenic infarction will develop splenic abscess. This infection develops via 1 of 2 mechanisms Bacteremic seeding of a bland infarction, created via splenic artery occlusion by embolized vegetations, or direct seeding of the spleen by an infected embolus also originating from an infected valvular vegetation. Viridans streptococci and S aureus each account for 40 per cent of cases in which splenic abscess cultures are positive, whereas the enterococci account for 15 per cent of cases. Aerobic Gram-negative bacilli and fungi are isolated in, 5 per cent of cases. Clinical splenomegaly, present in up to 30 per cent of cases of IE, is not a reliable sign of splenic infarction or abscess. Splenic infarction delineated by imaging techniques is often asymptomatic Back, left-flank, or left-upper-quadrant pain or abdominal tenderness, when present, may be associated with either splenic infarction or abscess. Splenic rupture with hemorrhage is a rare complication of infarction. Persistent or recurrent bacteremia, persistent fever, or other signs of sepsis are suggestive of splenic abscess, Abdominal CT or MRI appear to be the best tests for diagnosis of splenic abscess, with sensitivities and specificities of 90 per cent to 95 per cent. On ultrasonography, a sonolucent lesion suggests abscess. Infarcts are generally associated with clinical and radiographic improvement during appropriate antibiotic therapy. Ongoing sepsis, recurrent positive blood cultures, and persistence or enlargement of splenic defects CT or MRI suggest splenic abscess, which responds poorly to antibiotic therapy alone. Definitive treatment is splenectomy with appropriate antibiotics. Percutaneous drainage or aspiration of splenic abscess is an alternative to splenectomy for the patient who is a poor surgical candidate. Splenectomy should be performed before valve-replacement surgery because of the risk of infection of the valve prosthesis as a result of the bacteremia from abscess.


Related Discussions:- Splenic abscess

What is probing depth, What is Probing depth Probing depths can be infl...

What is Probing depth Probing depths can be influenced by the tissue type- shallow depths are associated with a keratinized collar, whereas deeper depths are associated with mo

Process of memory, Process of Memory: There are three stages of memory E...

Process of Memory: There are three stages of memory Encoding process: It is the process of receiving sensory input and transforming it into a form or code, which can be stored.

Is this the same thing as tonicity, These labs discuss the principle of osm...

These labs discuss the principle of osmolarity, which is defined as the total number of solute particles in 1 L of solution. Is this the same thing as tonicity? Explain your answer

Rna secondary structure, Most  RNA  molecules  are  single-stranded  but  a...

Most  RNA  molecules  are  single-stranded  but  an  RNA  molecule  should  hold regions  that  can  form  complementary   base  pairing  where  the  RNA  strand loops  back  on  i

Explain intergenic, Intergenic: Amongs the two genes; for example intergen...

Intergenic: Amongs the two genes; for example intergenic DNA is the DNA found amongs two genes. The term is frequently used to mean non-functional DNA (or at least DNA with no kno

Define triple sugar iron - carbohydrate utilization pattern, Define Triple ...

Define Triple Sugar iron - Carbohydrate Utilization Pattern? Triple sugar iron (TSI) agar is used to observe carbohydrate utilization pattern. The medium contains 1% concentr

What is dynamic auscultation in heart surgery, What is Dynamic Auscultation...

What is Dynamic Auscultation in heart surgery? It involves determining the effects on heart sounds and murmurs of various physiological and pharmacological manoeuvres, which al

Distinguish between epithelial and connective tissues, Distinguish between ...

Distinguish between epithelial and connective tissues with respect to their cell arrangement? PROVIDE a specific example (for both tissue types) of how the arrangement of cells hel

Define the petrifilm (dry film) method, Define the Petrifilm (dry film) Met...

Define the Petrifilm (dry film) Method? An alternative method to the conventional SPC is a Petrifilm (dry film) method. It is a non-petri dish plating system where a layer of n

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd