spirogyra, Biology

Assignment Help:
whats the meaning of asexual reproduction

Related Discussions:- spirogyra

Define fermented baked preparations, Normal 0 false false f...

Normal 0 false false false EN-US X-NONE X-NONE MicrosoftInternetExplorer4

Implantation, IMPLAN TA TIO N - Attachement of blastocyst on the ...

IMPLAN TA TIO N - Attachement of blastocyst on the endometrium of the uterus is called implantation. Generally it occurs 7th day after fertilisation. (6-10 days). Blas

Types of cell respiration, Q What are the kinds of cell respiration? Th...

Q What are the kinds of cell respiration? There are two types of cell respiration aerobic cell respiration a reaction with participation of molecular oxygen (O2) and anaerobic

Show the list of symptoms, Q. Show the list of symptoms? The list of sy...

Q. Show the list of symptoms? The list of symptoms includes: • Bulky, pale, loose, greasy and foul smelling stools. • Anorexia, feeling of fullness, pain abdomen. The

Explain mechanism for reduce the absorption of nutrients, Explain Mechanism...

Explain Mechanism for reduce the absorption of nutrients? The absorption of nutrients is also reduced by mechanisms other than increasing the viscosity of gastrointestinal cont

Define briefly about the pyridoxine vitamin, Define Briefly about the Pyrid...

Define Briefly about the Pyridoxine vitamin B 6 ? Pyridoxine or vitamin B 6 is one of the B complex vitamins which prevents and cures dermatitis in rats fed on vitamin B 6 de

Extracellular signals, extracellular signals and their characteristics

extracellular signals and their characteristics

Define chagas and arrhythmogenic right vent cardiomyopathy, Chagas' Cardiom...

Chagas' Cardiomyopathy It is common in south and Central America and is caused by Trypanosoma cruzi. Arrhythmogenic Right Ventricular Cardiomyopathy (ARVC) It is mark

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd