Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Spermatophores
Many non-chordates do not release free sperms during copulation. They have a mechanism to bundle and enclose a number of sperms in a sheath usually made of gelatinous material. Such bodies are called spermatophores. Most insects, the centipedes and certain molluscs produce spermatophores. Male centipede emits spermatophores and places it on a web already made. The female picks up the spermatophores and takes it into her genital opening. In many male cephalopods such as Loligo and Argonauta one of the arms gets specialised for the transfer of spermatophore into the females. Such an arm is called hectocotylized arm. The spermatophore, after having been deposited in the female, finally releases the sperms which move into the female ducts or the spermathaca.
Normal 0 false false false EN-IN X-NONE X-NONE
The use of the gums in various foods may affect the following functional properties: 1. Water-binding capacity 2. Rheological properties 3. Capacity to form film or gel
Q. Which respiratory adaptations or organs do aquatic and terrestrial arthropods respectively present? In crustaceans, typical aquatic beings, there are richly vascularized gil
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Q. Investigation of aortic regurgitation by Chest X–Ray? Left ventricular dilatation produces cardiomegaly on chest radiograph. Ascending aorta is often prominent. Egg shell ca
What are the Stages of soil The development of soil takes place in two stages. In the first stage there is formation of parent material which is generally consolidated and cons
In mountain rabbits, the EL-1 gene is located on chromosome 3. Four alleles of this gene have been identified in the population. With respect to EL-1, what is the maximum number of
MAJOR EVENTS DURING GASTRULATION - 1. There is rearrangement of cells due to morphogenetic movement of the cells of blastoderm. 2. The three primary germ layer g
Insect resistant crops (IRC) Insects are a natural selection pressure so plants resistant to certain insects could have an evolutionary advantage (in natural environments)
Advantages of mucoperiosteal flap There is no tissue loss It is advantageous in cases where there is deficiency of keratinized tissue and the soft tissue is not lost, but ma
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd