Spermatogenesis, Biology

Assignment Help:

SPERMATOGENESIS

  1. The process of maturation of reproductive cells in the testes of male to form spermatozoa (sperm) is known as spermatogenesis.
  2. The testes are formed of numerous tubular seminiferous tubules, held together in mesocharium connective tissue.
  3. Each seminiferous tubule shows an orderly arrangement of cells undergoing different phases of maturation.
  4. The peripheral layer of cells next to the basement membrane is formed of spermatogonia or the sperm mother cells and is often described as germinal epthelium.
  5. The spermatogonia undergo spermatogenesis to produce sperm.
  6. In between the groups of spermatogonia are tall columnar cells the sertoli cells.
  7. The spermatids undergoning differentiation into psermatonourishment to the developing sperm.
  8. Interspersed in the connective tissue is between the seminiferous tubules are present groups of interstitial cells or leyding cells which secrete male hormone (Testosteron).
  9. In vertebrate sperm production hologonic type (towards the central cavity).
  10. In insect sperm production is telogonic type (towards periphery).

1915_testis.png

 

T.S. of Testis

1014_seminiferous tubule.png

T. S. of Seminiferous tubules


Related Discussions:- Spermatogenesis

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Explain the main steps in the mongoose bioassay, Question : Explain the...

Question : Explain the main steps in the mongoose bioassay and the mouse bioassay as conducted for testing ciguatera in Mauritius? (i) Provide a brief description on the beh

Explain ancient greeks and romans - plant classification, Explain History o...

Explain History of Plant Classification - Ancient Greeks and Romans? Hippocrates, "The Father of Medicine" (460-377 B.C.) is reputed to have been one of Democritus 's disciples

Horse diseases-japanese encephalitis, Japanese encephalitis The Japane...

Japanese encephalitis The Japanese encephalitis is a mosquito-born flavivirus infection that causes encephalitis in human and equines and abortion in pigs, caused by Japanese

Explain stem cell therapy, Stem Cell Stem cell therapy could enable ind...

Stem Cell Stem cell therapy could enable individuals to survive and contribute their alleles to the gene pool who might not have already done so thus increasing genetic diversi

What are the ploidies of the new cells, Q. In which meiotic division does t...

Q. In which meiotic division does the separation of identical chromatids take place? And After the end of this process what are the ploidies of the new cells? The separation of

Define short- lived climatic stressful conditions, How do organisms like:- ...

How do organisms like:- a) fungi, b) zooplanktons and c) bears overcome the temporary short- lived climatic stressful conditions? Define.

Describe open circulatory system, Q. What is an open circulatory system? ...

Q. What is an open circulatory system? Open circulatory system is the one in which blood doesn't circulate only inside blood vessels but it also falls in cavities that irrigate

What is the cellular structure to which mrna molecules bind, What is the ce...

What is the cellular structure to which mRNA molecules bind to start the protein synthesis? To make proteins mRNA molecules of necessity associate to ribosomes. Ribosomes have

How sugar used in flavors and mouthfeel, How sugar used in Flavors and Mout...

How sugar used in Flavors and Mouthfeel? In frozen desserts, sugars balance flavor and mouthfeel. Since low temperatures tend to numb the taste buds, sugars enhance flavors, th

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd