Speciation, Biology

Assignment Help:

SPECIATION -

  • Origin of new species: An isolated population of a species independently develops different types of mutations.
  • The later accumulate in its gene pool. After several generations, the isolated population becomes genetically and reproductively different from others so as to constitute a new species.
  • The million of different species that exist today did not emerge by any single sequence of events but have come into existence by following types different paths of speciation.

1.       PHYLECTIC SPECIATION -

  • Darwin entitled his great book.
  • For Darwin, speciation was the simple, gradual accumulation of changes in a lineage throughout time, until the group was distinct enough to be considered a new species. This process is now called phyletic speciation.

2.       ALLOPATRIC SPECIATION -

  • It is considered as the most common type of speciation.
  • Allopatric speciation typically occurs when a physical barrier i. e., a mountain range, a river, or an oil pipeline, geographically separates a population from its parental population.
  • E.g., Different species of Darwin finches in the Galapagos Island.

3.       SYMPATRIC SPECIATION -

  • Sympatric speciation occurs in populations where individuals continue to live among one another, even though some type of biological difference, such as the time of the year when gonads mature, has divided the members into different reproductive groups.
  • The best accepted cases of sympatric speciation occur in plants as a result of polyploidy, an increase in the number of sets of chromosomes per cell occurs.

4.       PARAPATRIC SPECIATION -

  • Parapatric speciation is thought to occur in populations that lie adjacent to one another.
  • Gene pools diverge because the environment varies sufficiently in the different localities.
  • As a result, different traits are selected in each population.

Related Discussions:- Speciation

Sample titration - estimation of nitrogen & protein content, Define Sample ...

Define Sample Titration - Estimation of nitrogen and protein content? Take the given ammonium sulfate solution into a 100 ml volumetric flask and dilute to the mark with distil

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Explain the storage of vitamin e, Explain the Storage of Vitamin E? Vi...

Explain the Storage of Vitamin E? Vitamin E is mainly stored in muscles and adipose tissue. Vitamin E content of erythrocytes is about 20 percent of that in plasma and there i

Limitations of computed tomograpy scan, Limitations of Computed Tomograpy S...

Limitations of Computed Tomograpy Scan  This technology is costly  Increased amount for radiation

What is a membrane, What is a membrane? Membrane is any delicate sheet ...

What is a membrane? Membrane is any delicate sheet that divides one region from another blocking or permitting (selectively or completely) the passage of substances. The skin,

Define about the absorption of iron, Define about the Absorption of Iron? ...

Define about the Absorption of Iron? Before it can be absorbed, iron whether it is in the form of haem or non-haem must be released from the food matrices where it is bond with

Countercurrent flow, Countercurrent flow is the arrangement by which fish ...

Countercurrent flow is the arrangement by which fish get oxygen from the water which flows by the help of their gills. The water flows across the respiratory surface of the gill i

Discuss haematoxylin and its subtypes in detail, Question 1 Discuss how yo...

Question 1 Discuss how you would perform mounting of stained sections. List commonly used mounting media in histopathology laboratory. Add a note on advantages and disadvantages o

Define isolated soybean proteins in infant formulas, Define isolated soybea...

Define isolated soybean proteins in Infant formulas? Infant formulas, where milk solids have been replaced by soy products, are well established commercial products. ISP is the

What is hipot test ?, Hipot is an abbreviation for high potential. Usually,...

Hipot is an abbreviation for high potential. Usually, Hipot is a term given to a class of electrical safety testing instruments used to confirm electrical insulation in finished ap

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd